Incidental Mutation 'R1702:Gabrg3'
ID189800
Institutional Source Beutler Lab
Gene Symbol Gabrg3
Ensembl Gene ENSMUSG00000055026
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
SynonymsGabrg-3, B230362M20Rik
MMRRC Submission 039735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1702 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location56716465-57387188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56985100 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000067632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068911]
Predicted Effect probably damaging
Transcript: ENSMUST00000068911
AA Change: T112A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067632
Gene: ENSMUSG00000055026
AA Change: T112A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 47 253 2.9e-51 PFAM
Pfam:Neur_chan_memb 260 461 1.4e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,289,028 C2126S probably damaging Het
Abca15 T C 7: 120,382,702 V1080A probably benign Het
Abcg4 A C 9: 44,275,073 V553G probably damaging Het
Ache T C 5: 137,290,989 V319A possibly damaging Het
Acsm2 T A 7: 119,573,564 M134K possibly damaging Het
Ank2 A T 3: 126,955,899 S494T probably benign Het
Asic3 A T 5: 24,415,456 T202S probably damaging Het
Baiap3 T A 17: 25,244,805 H886L probably damaging Het
Cidea T A 18: 67,366,421 I126K probably damaging Het
Cmklr1 T G 5: 113,613,842 K366T probably benign Het
Cntrl A T 2: 35,171,836 probably null Het
Crhr2 A G 6: 55,092,535 F378S probably damaging Het
Deaf1 C G 7: 141,314,954 R303T probably damaging Het
Dnah9 T A 11: 66,085,195 N1343Y possibly damaging Het
Dopey2 A G 16: 93,747,621 K99E possibly damaging Het
Dpp4 A T 2: 62,386,429 probably null Het
Dst T C 1: 34,167,340 V598A probably damaging Het
Ece2 C T 16: 20,631,246 R136C probably damaging Het
Egf C A 3: 129,690,811 V453L probably benign Het
Egr3 T A 14: 70,079,767 F342L probably damaging Het
Eif2ak2 A T 17: 78,856,634 I434N probably damaging Het
Emc1 A G 4: 139,375,201 T936A probably damaging Het
Fmod A T 1: 134,040,762 E180V probably damaging Het
Gak T C 5: 108,606,376 probably null Het
Gas2 T A 7: 51,953,341 probably null Het
Gm11639 C T 11: 104,691,006 P58L probably benign Het
Gm2381 T A 7: 42,820,231 Q156H probably benign Het
Golga2 T A 2: 32,299,275 S273T probably damaging Het
Homez T A 14: 54,856,995 T419S probably damaging Het
Igfbp6 T A 15: 102,148,182 Y184* probably null Het
Il11 A G 7: 4,773,734 S86P probably damaging Het
Itgal A G 7: 127,305,025 N270S probably benign Het
Lama2 T C 10: 27,190,529 R1119G probably benign Het
Lamp3 G T 16: 19,676,072 N294K probably benign Het
Mars T C 10: 127,310,079 I113M possibly damaging Het
Mgat5b A G 11: 116,948,659 T334A possibly damaging Het
Mis18bp1 A G 12: 65,161,744 I65T probably benign Het
Mmrn2 A T 14: 34,397,914 N247I probably benign Het
Muc6 G T 7: 141,650,487 N322K probably damaging Het
Mx2 A G 16: 97,558,683 H551R probably benign Het
Mylk T A 16: 34,921,944 V942E probably benign Het
Nes A G 3: 87,975,979 E515G probably benign Het
Nfatc3 T G 8: 106,092,160 S503R probably damaging Het
Nkain3 C A 4: 20,158,339 probably null Het
Noxa1 A G 2: 25,092,584 V73A probably damaging Het
Nup160 A T 2: 90,683,958 E83D probably damaging Het
Olfr1427 C A 19: 12,099,166 V158L probably benign Het
Olfr205 C A 16: 59,329,141 V123L probably benign Het
Olfr530 A T 7: 140,372,742 Y289* probably null Het
Olfr923 A G 9: 38,828,543 Y284C probably damaging Het
Plxnb2 A G 15: 89,161,984 probably null Het
Rundc3b A G 5: 8,512,318 V350A probably benign Het
Scn1a C T 2: 66,318,223 D993N probably damaging Het
Sec24c G T 14: 20,686,573 G226V probably null Het
Sept11 T A 5: 93,156,924 I200N probably damaging Het
Shank3 G T 15: 89,499,896 G14C probably damaging Het
Slc25a39 T C 11: 102,406,626 D5G possibly damaging Het
Stoml3 A T 3: 53,505,431 T169S probably benign Het
Taf1b T A 12: 24,509,126 I83K possibly damaging Het
Tarbp1 T A 8: 126,428,218 Q1389L probably damaging Het
Thbs1 T A 2: 118,113,442 D180E probably benign Het
Tmc5 T A 7: 118,672,239 V925D probably benign Het
Tmem62 T C 2: 120,979,227 V130A probably damaging Het
Tpp2 C T 1: 43,990,548 P997L probably damaging Het
Trip12 A T 1: 84,745,063 I127N probably damaging Het
Ttc37 A G 13: 76,122,743 K153R possibly damaging Het
Upp2 T C 2: 58,771,550 F142L possibly damaging Het
Usf3 C T 16: 44,219,632 Q1492* probably null Het
Vcp T C 4: 42,990,840 D205G probably damaging Het
Vmn1r180 G A 7: 23,952,969 V186I possibly damaging Het
Washc2 T C 6: 116,229,306 S496P probably damaging Het
Wee2 T C 6: 40,464,201 I480T probably benign Het
Xylt2 T A 11: 94,668,745 H357L probably damaging Het
Zbed4 T C 15: 88,780,853 S375P probably damaging Het
Zfp442 A T 2: 150,409,180 Y266* probably null Het
Zfp600 A G 4: 146,196,927 T722A probably benign Het
Zfp976 T A 7: 42,616,000 H55L possibly damaging Het
Other mutations in Gabrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Gabrg3 APN 7 57381667 missense probably damaging 0.99
IGL01501:Gabrg3 APN 7 56724466 missense probably damaging 0.99
IGL02637:Gabrg3 APN 7 56735027 missense probably damaging 0.99
IGL02707:Gabrg3 APN 7 56982691 nonsense probably null
IGL03084:Gabrg3 APN 7 56735064 missense possibly damaging 0.91
IGL03237:Gabrg3 APN 7 56982712 splice site probably null
IGL03275:Gabrg3 APN 7 56773347 missense probably damaging 1.00
IGL03309:Gabrg3 APN 7 56982685 missense probably damaging 1.00
R0265:Gabrg3 UTSW 7 57381617 nonsense probably null
R0612:Gabrg3 UTSW 7 56729706 missense probably damaging 0.99
R0627:Gabrg3 UTSW 7 56724595 missense probably damaging 0.99
R0676:Gabrg3 UTSW 7 56724421 missense probably damaging 0.99
R1178:Gabrg3 UTSW 7 56735091 missense probably benign 0.01
R1600:Gabrg3 UTSW 7 56735074 nonsense probably null
R1836:Gabrg3 UTSW 7 56729641 missense probably damaging 1.00
R2327:Gabrg3 UTSW 7 56735087 missense probably benign 0.01
R3816:Gabrg3 UTSW 7 57381664 nonsense probably null
R3818:Gabrg3 UTSW 7 57381664 nonsense probably null
R3819:Gabrg3 UTSW 7 57381664 nonsense probably null
R4905:Gabrg3 UTSW 7 56724556 missense probably damaging 0.98
R5643:Gabrg3 UTSW 7 56773284 missense possibly damaging 0.95
R6088:Gabrg3 UTSW 7 56985078 missense probably damaging 1.00
R6862:Gabrg3 UTSW 7 56773311 missense possibly damaging 0.54
R6879:Gabrg3 UTSW 7 57381639 missense probably damaging 1.00
R7075:Gabrg3 UTSW 7 57323696 missense not run
Predicted Primers PCR Primer
(F):5'- TCAAGGTCCCAGGAAGTCCACATAG -3'
(R):5'- GCGGAACAAAGGTCATTGATTCACC -3'

Sequencing Primer
(F):5'- TCATAAGTCCAGCCTTGAGTG -3'
(R):5'- AAAGGTCATTGATTCACCTACCCTG -3'
Posted On2014-05-14