Incidental Mutation 'R1720:S100pbp'
ID191363
Institutional Source Beutler Lab
Gene Symbol S100pbp
Ensembl Gene ENSMUSG00000040928
Gene NameS100P binding protein
Synonyms4930429A08Rik
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R1720 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129148005-129189727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129182093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 146 (D146E)
Ref Sequence ENSEMBL: ENSMUSP00000113920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049081] [ENSMUST00000072431] [ENSMUST00000106059] [ENSMUST00000106061] [ENSMUST00000117350] [ENSMUST00000117497] [ENSMUST00000117965]
Predicted Effect probably damaging
Transcript: ENSMUST00000049081
AA Change: D146E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039820
Gene: ENSMUSG00000040928
AA Change: D146E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 382 4.4e-194 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072431
AA Change: D110E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072258
Gene: ENSMUSG00000040928
AA Change: D110E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 108 1.6e-36 PFAM
Pfam:S100PBPR 107 162 2.1e-17 PFAM
Pfam:S100PBPR 153 304 6.6e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106059
AA Change: D69E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101674
Gene: ENSMUSG00000040928
AA Change: D69E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 67 1.2e-23 PFAM
Pfam:S100PBPR 66 121 1.1e-17 PFAM
Pfam:S100PBPR 112 263 4.9e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106061
AA Change: D146E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101676
Gene: ENSMUSG00000040928
AA Change: D146E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 382 8.5e-193 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117350
AA Change: D146E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113214
Gene: ENSMUSG00000040928
AA Change: D146E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 337 1.4e-147 PFAM
low complexity region 353 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117497
AA Change: D146E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113084
Gene: ENSMUSG00000040928
AA Change: D146E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 198 2.4e-83 PFAM
Pfam:S100PBPR 189 327 1.1e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117965
AA Change: D146E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113920
Gene: ENSMUSG00000040928
AA Change: D146E

DomainStartEndE-ValueType
Pfam:S100PBPR 21 198 2.4e-83 PFAM
Pfam:S100PBPR 189 327 1.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151971
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was originally identified by its interaction with S100 calcium-binding protein P. Expression of this protein has been reported to be associated with pancreatic ductal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in S100pbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:S100pbp APN 4 129182108 missense possibly damaging 0.94
IGL02302:S100pbp APN 4 129182441 missense probably damaging 1.00
IGL02554:S100pbp APN 4 129181851 splice site probably null
R0068:S100pbp UTSW 4 129144456 unclassified probably benign
R2058:S100pbp UTSW 4 129182100 missense probably benign 0.02
R2415:S100pbp UTSW 4 129181821 missense possibly damaging 0.67
R2762:S100pbp UTSW 4 129155426 nonsense probably null
R4815:S100pbp UTSW 4 129150933 unclassified probably benign
R5537:S100pbp UTSW 4 129182188 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCACAACCTGATTTATGTGAGCCACTG -3'
(R):5'- GCTGAAACCCCTGGCTTCCTAAAAC -3'

Sequencing Primer
(F):5'- AACACAGGGGTAGGTTTCTTACTTTC -3'
(R):5'- TGGCTTCCTAAAACTACCTCAAC -3'
Posted On2014-05-14