Incidental Mutation 'R1747:Arhgap28'
ID194081
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1747 (G1)
Quality Score159
Status Validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67901309 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 105 (A105S)
Ref Sequence ENSEMBL: ENSMUSP00000024840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably benign
Transcript: ENSMUST00000024840
AA Change: A105S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: A105S

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163865
AA Change: A55S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: A55S

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164647
AA Change: A55S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: A55S

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4347:Arhgap28 UTSW 17 67873142 missense probably benign
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTTAATGTCAGGAGCGTCAGCAG -3'
(R):5'- ATGGCTTTACACAGGCACCCAG -3'

Sequencing Primer
(F):5'- CAGGCCCAGTCTGTTTGAAG -3'
(R):5'- TCAGAAAATCCATTCCTCGCTG -3'
Posted On2014-05-23