Incidental Mutation 'R1725:Mill2'
ID198073
Institutional Source Beutler Lab
Gene Symbol Mill2
Ensembl Gene ENSMUSG00000040987
Gene NameMHC I like leukocyte 2
Synonyms
MMRRC Submission 039757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R1725 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18839966-18865402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18840068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 26 (D26G)
Ref Sequence ENSEMBL: ENSMUSP00000154222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]
Predicted Effect unknown
Transcript: ENSMUST00000072386
AA Change: D26G
SMART Domains Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987
AA Change: D26G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I_3 39 224 2.5e-14 PFAM
Pfam:MHC_I 49 225 1.5e-33 PFAM
IGc1 244 316 7.82e-6 SMART
low complexity region 332 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072415
AA Change: D26G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987
AA Change: D26G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:MHC_I 34 210 5.9e-33 PFAM
IGc1 229 301 7.82e-6 SMART
low complexity region 317 339 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206487
AA Change: D26G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207014
Predicted Effect probably benign
Transcript: ENSMUST00000227379
AA Change: D26G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect unknown
Transcript: ENSMUST00000228493
AA Change: D26G
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T G 19: 58,792,762 K10T probably benign Het
2310079G19Rik A T 16: 88,627,275 F109L probably benign Het
Aacs T C 5: 125,482,935 probably null Het
Abcc6 C A 7: 45,992,357 D866Y possibly damaging Het
Acox3 T C 5: 35,592,172 Y214H probably benign Het
Acss2 A G 2: 155,556,844 T404A possibly damaging Het
Adgrb3 T A 1: 25,826,300 E154V probably damaging Het
Akap12 G A 10: 4,353,942 V251M probably damaging Het
Ambp A T 4: 63,144,276 M242K possibly damaging Het
Angptl7 T G 4: 148,500,012 Y93S probably damaging Het
Apof A G 10: 128,269,811 probably benign Het
Arv1 T C 8: 124,728,452 F135L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cacna1s C T 1: 136,098,623 T1116I probably damaging Het
Ccdc91 A G 6: 147,592,043 E311G unknown Het
Cenpf T C 1: 189,680,479 T196A probably damaging Het
Chd8 A T 14: 52,232,573 S527T probably benign Het
Csmd3 A C 15: 47,596,807 N3529K probably damaging Het
Csnk2a1 T C 2: 152,257,972 V116A probably damaging Het
Dhx36 T G 3: 62,506,939 M1L probably benign Het
Diaph3 A G 14: 86,966,323 probably null Het
Ephb2 G A 4: 136,659,778 Q714* probably null Het
Eprs T A 1: 185,406,992 L858Q probably damaging Het
Espl1 G T 15: 102,313,221 V982L probably benign Het
Eya2 A G 2: 165,724,685 T219A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl18 C T 5: 142,886,703 R259H probably damaging Het
Gcc2 G A 10: 58,304,115 R1629H possibly damaging Het
Gje1 G A 10: 14,716,424 R205* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Kmt2d T C 15: 98,845,234 probably benign Het
Krt6a A T 15: 101,692,557 M268K probably damaging Het
Loxhd1 T A 18: 77,293,241 S85T probably benign Het
Loxl3 G A 6: 83,035,593 V38I probably benign Het
Muc15 T C 2: 110,731,246 L9S probably damaging Het
Nat8f4 G A 6: 85,901,098 R148* probably null Het
Nav3 A T 10: 109,823,590 V722E probably damaging Het
Nfkb1 C A 3: 135,667,758 G10W probably damaging Het
Olfr1477 T C 19: 13,502,519 Y59H probably damaging Het
Olfr16 C T 1: 172,957,341 P182L possibly damaging Het
Olfr31 T G 14: 14,328,977 Y289D probably damaging Het
Olfr705 A T 7: 106,714,058 F208I probably benign Het
Pcdhb22 T A 18: 37,520,188 C313S probably benign Het
Plin4 A G 17: 56,106,473 L384P probably damaging Het
Pm20d1 T C 1: 131,816,058 I487T probably damaging Het
Prex1 A T 2: 166,601,736 D334E probably damaging Het
Psg28 A T 7: 18,428,011 I189N possibly damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rae1 A G 2: 173,006,961 I123M possibly damaging Het
Sh3glb2 C A 2: 30,350,667 E129* probably null Het
Simc1 T C 13: 54,526,406 S856P probably damaging Het
Slc19a1 T A 10: 77,041,838 M69K probably benign Het
Slc30a8 A T 15: 52,333,604 I304F possibly damaging Het
Snx1 A G 9: 66,098,329 probably null Het
Stx18 G A 5: 38,135,255 V234M probably damaging Het
Sulf2 T C 2: 166,081,361 T615A probably damaging Het
Sult3a2 T A 10: 33,779,709 K91N probably benign Het
Tet1 A G 10: 62,814,477 S22P probably damaging Het
Tmc3 T C 7: 83,604,732 V362A probably damaging Het
Trim16 A C 11: 62,820,505 M1L possibly damaging Het
Trp53bp1 C T 2: 121,252,000 V10I possibly damaging Het
Ttc12 T G 9: 49,458,115 D235A probably benign Het
Ttn T C 2: 76,862,383 R452G possibly damaging Het
Ugt2b38 A T 5: 87,411,871 H387Q probably damaging Het
Usp48 T A 4: 137,633,422 L20* probably null Het
Utrn T C 10: 12,663,519 D1918G probably damaging Het
Vmn1r158 A G 7: 22,790,647 S46P probably benign Het
Vmn2r97 T A 17: 18,929,135 W262R probably benign Het
Vps13d A T 4: 145,143,260 S1917T possibly damaging Het
Vsx1 T C 2: 150,686,200 N158D probably benign Het
Vwf G A 6: 125,646,282 V1781I probably benign Het
Wrap73 T C 4: 154,148,752 Y128H possibly damaging Het
Zfp472 A G 17: 32,977,337 K129E possibly damaging Het
Zscan18 A T 7: 12,770,857 L611Q probably damaging Het
Other mutations in Mill2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Mill2 APN 7 18856640 missense probably damaging 0.98
IGL02465:Mill2 APN 7 18858243 nonsense probably null
IGL02876:Mill2 APN 7 18856507 missense probably damaging 1.00
R1945:Mill2 UTSW 7 18841494 missense probably benign 0.00
R1964:Mill2 UTSW 7 18856604 missense probably damaging 1.00
R2260:Mill2 UTSW 7 18856488 missense probably benign 0.14
R3160:Mill2 UTSW 7 18856174 missense probably benign 0.32
R3162:Mill2 UTSW 7 18856174 missense probably benign 0.32
R4302:Mill2 UTSW 7 18856531 missense probably damaging 0.98
R4946:Mill2 UTSW 7 18856683 critical splice donor site probably null
R5121:Mill2 UTSW 7 18856666 missense probably benign 0.39
R5365:Mill2 UTSW 7 18858414 missense probably benign 0.01
R5557:Mill2 UTSW 7 18855959 nonsense probably null
R5736:Mill2 UTSW 7 18858249 missense probably benign 0.01
R5998:Mill2 UTSW 7 18840064 missense probably benign 0.00
R6004:Mill2 UTSW 7 18856538 missense probably benign 0.32
R6016:Mill2 UTSW 7 18856448 missense probably benign 0.45
R6045:Mill2 UTSW 7 18856564 missense probably benign 0.01
R6534:Mill2 UTSW 7 18856596 missense possibly damaging 0.91
R6913:Mill2 UTSW 7 18856426 missense probably null 1.00
Z1088:Mill2 UTSW 7 18856399 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGGAGGAATCTGTTGGTGTAAGAGA -3'
(R):5'- TGTGCCTATGCGCTCTGACCTATT -3'

Sequencing Primer
(F):5'- cccagcagaggcagcag -3'
(R):5'- tctctttttcttccccctttcc -3'
Posted On2014-05-23