Incidental Mutation 'R1732:Dmxl1'
ID199433
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission 039764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R1732 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49902988 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 2359 (H2359Q)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably benign
Transcript: ENSMUST00000041772
AA Change: H2359Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: H2359Q

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180611
AA Change: H2359Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: H2359Q

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181907
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C A 12: 71,219,221 Q1445K probably benign Het
Acacb A T 5: 114,190,087 M303L possibly damaging Het
Actl9 T C 17: 33,433,122 V52A probably damaging Het
Adam7 T C 14: 68,498,450 T781A probably benign Het
Agpat4 T C 17: 12,216,728 V293A probably benign Het
Ank1 T A 8: 23,111,463 probably benign Het
Atp1a1 C A 3: 101,584,799 G587V probably damaging Het
Avpr1b T C 1: 131,600,254 F172L probably damaging Het
Bmp1 A T 14: 70,486,265 D710E possibly damaging Het
Cep126 A T 9: 8,099,761 I924N probably benign Het
Chek2 G T 5: 110,872,102 A517S probably benign Het
Cmbl A T 15: 31,588,232 E165D probably damaging Het
Cntnap3 A T 13: 64,740,812 probably null Het
Col1a1 A T 11: 94,944,415 probably benign Het
Ctbp2 T C 7: 132,998,924 M624V possibly damaging Het
Cwc15 A G 9: 14,510,247 D203G probably benign Het
Cyld C T 8: 88,731,667 probably benign Het
Cyp3a57 A T 5: 145,365,645 I84F probably damaging Het
Dennd3 T A 15: 73,537,418 probably benign Het
Desi2 A C 1: 178,256,651 probably benign Het
Ephb4 A G 5: 137,372,178 N880S possibly damaging Het
F10 T C 8: 13,050,764 L214P probably damaging Het
F5 G A 1: 164,174,150 V141M probably damaging Het
Fam135a A T 1: 24,026,653 S1022T possibly damaging Het
Fam13b A T 18: 34,487,134 N232K probably benign Het
Fyco1 T C 9: 123,819,092 E1259G probably benign Het
Gak A T 5: 108,576,582 D1087E probably benign Het
Gm7138 A T 10: 77,776,848 probably benign Het
Gm8674 T A 13: 49,901,926 noncoding transcript Het
Gpr25 A G 1: 136,260,128 V249A probably benign Het
Hcn3 T C 3: 89,148,119 H607R probably damaging Het
Hdac4 T A 1: 91,947,535 T905S probably benign Het
Itgad T C 7: 128,205,107 S86P probably benign Het
Itgb4 G T 11: 115,988,918 R632L probably damaging Het
Kcnb2 A T 1: 15,709,755 T284S probably benign Het
Klhl22 T A 16: 17,777,024 M339K probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mybpc2 C A 7: 44,513,675 V484L probably benign Het
Noa1 A T 5: 77,306,374 V473E probably benign Het
Nwd1 C G 8: 72,666,835 S242C possibly damaging Het
Olfr545 C A 7: 102,494,040 C245F probably damaging Het
Olfr868 A G 9: 20,101,500 H247R probably damaging Het
Otof A T 5: 30,386,471 W535R probably damaging Het
Peg3 T C 7: 6,709,085 E1046G possibly damaging Het
Phldb2 T C 16: 45,757,166 E1132G probably damaging Het
Phtf2 A T 5: 20,789,627 probably null Het
Plce1 G T 19: 38,716,838 A896S possibly damaging Het
Prim1 T C 10: 128,015,324 Y26H probably damaging Het
Prr12 T A 7: 45,048,356 T712S unknown Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Ptpdc1 T C 13: 48,586,545 E409G probably benign Het
Rabep1 A G 11: 70,904,641 N274S probably damaging Het
Rbm14 A G 19: 4,803,467 S296P probably benign Het
Rec114 A G 9: 58,653,106 S206P probably damaging Het
Rps6ka1 A T 4: 133,860,070 Y531N probably damaging Het
Slc28a2 T C 2: 122,449,758 probably benign Het
Slc34a1 A G 13: 55,413,420 H566R probably benign Het
Slc9c1 A G 16: 45,552,928 T290A probably benign Het
Smarcc1 T A 9: 110,185,820 probably benign Het
Srp54b T A 12: 55,252,759 probably null Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Synj1 T C 16: 90,964,230 K710E probably damaging Het
Tenm3 T A 8: 48,310,634 D795V probably damaging Het
Tgm2 T C 2: 158,134,357 Y149C probably damaging Het
Tmem151a C A 19: 5,082,867 A104S probably damaging Het
Top1mt A G 15: 75,666,251 probably null Het
Tpgs1 T A 10: 79,675,594 L190Q possibly damaging Het
Triobp T A 15: 78,967,228 H527Q possibly damaging Het
Tspan2 A G 3: 102,768,877 I197V probably damaging Het
Ube3b A G 5: 114,387,445 I76V probably benign Het
Vmn1r32 A T 6: 66,553,301 S164T probably benign Het
Zfp607a G T 7: 27,878,459 C318F probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGGAAGAAGCTCAGTCAGGAC -3'
(R):5'- TACCACTACCTGGTGAGGGCTAGGC -3'

Sequencing Primer
(F):5'- AAGCTCAGTCAGGACTTACAG -3'
(R):5'- GCATAGCAAAGTGCCTTCCTG -3'
Posted On2014-05-23