Incidental Mutation 'R4916:Dmxl1'
ID380129
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission 042518-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R4916 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49877697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 974 (S974P)
Ref Sequence ENSEMBL: ENSMUSP00000045559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: S974P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: S974P

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: S974P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: S974P

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595D18Rik G A 12: 111,174,935 Q19* probably null Het
5430419D17Rik T A 7: 131,174,477 probably null Het
6030468B19Rik T A 11: 117,806,266 C230* probably null Het
A730017C20Rik A T 18: 59,072,205 I22F probably damaging Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Adnp T A 2: 168,187,617 T51S possibly damaging Het
Agap3 C A 5: 24,478,013 A464D probably damaging Het
Ago4 A C 4: 126,506,842 C693G probably damaging Het
Ahi1 A G 10: 20,984,404 R675G probably damaging Het
Amigo1 T A 3: 108,187,665 L160Q probably damaging Het
Ankrd35 T C 3: 96,684,122 S575P probably benign Het
Ano3 T A 2: 110,771,020 T298S possibly damaging Het
Ap2b1 T G 11: 83,390,706 F813V probably damaging Het
Aplnr T G 2: 85,136,917 F95L probably damaging Het
Apobec2 T C 17: 48,423,125 E171G probably benign Het
Ascc1 A G 10: 60,004,862 N15S probably benign Het
AY358078 T A 14: 51,802,651 Y73N unknown Het
B3gnt8 C A 7: 25,628,883 P246Q probably damaging Het
C2cd2l T C 9: 44,316,560 Q250R probably damaging Het
Camk2d T C 3: 126,783,975 Y180H probably damaging Het
Ccdc129 C T 6: 55,978,190 P928S possibly damaging Het
Ccdc170 A G 10: 4,518,971 E167G probably damaging Het
Cdyl2 A G 8: 116,579,187 M445T probably damaging Het
Clca1 T C 3: 145,015,844 D322G probably benign Het
Cnot10 C T 9: 114,629,134 M101I possibly damaging Het
Cntrl C T 2: 35,165,682 T1196M probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcaf6 T C 1: 165,420,205 D153G probably damaging Het
Dennd2c G A 3: 103,131,824 G96E probably benign Het
Dhrs9 T C 2: 69,401,408 F304S probably damaging Het
Dnah6 T C 6: 73,192,676 probably benign Het
Dnah7c T C 1: 46,595,008 L1049P probably damaging Het
Dnajc2 T C 5: 21,757,340 K621E probably damaging Het
Ehbp1 T C 11: 22,146,592 D299G probably benign Het
Erap1 A G 13: 74,646,528 E102G probably benign Het
Fasn T G 11: 120,816,646 N799T probably benign Het
Fbxl20 T C 11: 98,128,360 D22G probably damaging Het
Fgfr1 T C 8: 25,563,526 probably null Het
Frzb A T 2: 80,446,527 I105N probably damaging Het
Gabrb1 T A 5: 71,869,421 F55Y probably damaging Het
Gatd1 G T 7: 141,409,097 C216* probably null Het
Gnl2 A C 4: 125,043,692 N255T probably damaging Het
Golgb1 A T 16: 36,916,118 Q1909L probably benign Het
Gpnmb T C 6: 49,051,970 L474P probably damaging Het
H60b T C 10: 22,287,216 V230A possibly damaging Het
Hmcn2 T A 2: 31,360,980 V818D probably damaging Het
Jade2 G T 11: 51,817,082 T768K probably benign Het
Kif28 T C 1: 179,702,520 H692R probably benign Het
Kmt2b T C 7: 30,578,517 N1634S probably damaging Het
Knop1 A G 7: 118,846,076 W222R probably damaging Het
Lrmp C A 6: 145,165,301 S277R probably damaging Het
Map1b T C 13: 99,433,300 D971G unknown Het
Mapk7 G T 11: 61,493,649 T77K probably damaging Het
Mcm6 A G 1: 128,348,977 L292P probably damaging Het
Megf8 T C 7: 25,339,664 L900P probably benign Het
Meis1 G A 11: 18,881,776 H421Y possibly damaging Het
Mllt1 T C 17: 56,899,813 T344A probably benign Het
Mta1 T A 12: 113,136,540 S657T probably benign Het
Mtus1 C A 8: 41,000,801 K998N probably damaging Het
Ncdn G A 4: 126,749,938 L364F possibly damaging Het
Ndufb7 T C 8: 83,570,905 L63P probably damaging Het
Nfix T C 8: 84,771,829 I172V probably benign Het
Nos1 T C 5: 117,947,570 probably null Het
Nrp1 C A 8: 128,502,804 S921* probably null Het
Olfr1459 T A 19: 13,145,991 I223L possibly damaging Het
Olfr401 A T 11: 74,121,879 I197F probably benign Het
Oma1 T C 4: 103,319,530 probably null Het
Pcp2 T A 8: 3,625,534 probably benign Het
Pdk4 T A 6: 5,489,157 H250L possibly damaging Het
Phldb3 A G 7: 24,624,291 H449R probably benign Het
Pip4k2c T C 10: 127,199,327 T391A possibly damaging Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ppfia2 G C 10: 106,762,117 L180F probably damaging Het
Prkcg T G 7: 3,330,265 Y624* probably null Het
Psmg2 A G 18: 67,648,856 E164G probably damaging Het
Rb1 A T 14: 73,216,691 L589H probably damaging Het
Rcvrn A T 11: 67,695,765 I117F probably damaging Het
Rere T A 4: 150,619,144 W1528R probably damaging Het
Robo2 A G 16: 73,898,915 S1447P possibly damaging Het
Scfd2 C A 5: 74,462,658 G405W probably damaging Het
Scin T A 12: 40,069,374 I552F possibly damaging Het
Serpina3k G A 12: 104,343,010 V238M probably damaging Het
Slc1a6 G A 10: 78,796,251 V304M probably damaging Het
Slc20a2 C T 8: 22,561,004 S351L probably damaging Het
Slc31a2 T C 4: 62,297,088 V124A probably damaging Het
Slc38a3 T C 9: 107,656,227 N244S probably benign Het
Slc4a1 A G 11: 102,352,453 V784A probably damaging Het
Slc6a5 T C 7: 49,948,256 F623L probably benign Het
Slf2 T G 19: 44,971,661 D1022E probably damaging Het
Slfn8 G A 11: 83,016,878 H280Y probably damaging Het
Smpdl3a A T 10: 57,801,031 D45V probably damaging Het
Ssh3 T C 19: 4,265,142 E342G probably damaging Het
Tacr1 A T 6: 82,554,941 I273F probably benign Het
Tfg T A 16: 56,694,396 probably null Het
Tmem179 A G 12: 112,501,834 L71P probably damaging Het
Tmem63a T A 1: 180,966,521 I541N probably benign Het
Traj20 G A 14: 54,199,467 probably benign Het
Trappc13 A T 13: 104,154,294 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tulp1 A G 17: 28,359,135 L310P probably damaging Het
Ube2cbp A G 9: 86,422,872 Y306H probably damaging Het
Urb1 A T 16: 90,783,328 V649E probably damaging Het
Vps13d A G 4: 144,983,393 L4211P probably damaging Het
Vwa5b1 T A 4: 138,594,262 I407F possibly damaging Het
Vwce G T 19: 10,646,879 C378F probably damaging Het
Zfp791 T A 8: 85,110,951 I95L probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5484:Dmxl1 UTSW 18 49889464 missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGGTTGTTAACATCTTGTG -3'
(R):5'- CCATCTTCAATGAGTAATGGCC -3'

Sequencing Primer
(F):5'- AAGAACAGTTGGGTGCTCTTACC -3'
(R):5'- TGAGTAATGGCCATTCTTCCCAAAC -3'
Posted On2016-04-15