Incidental Mutation 'R5484:Dmxl1'
ID484524
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene NameDmx-like 1
SynonymsC630007L23Rik
MMRRC Submission 043045-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R5484 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location49832670-49965473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49889464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1623 (V1623E)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: V1623E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: V1623E

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: V1623E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: V1623E

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181907
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,471,931 H609R probably benign Het
Abca6 A T 11: 110,184,073 V1388E probably damaging Het
Alx1 T A 10: 103,025,316 D117V probably damaging Het
Ascl4 T C 10: 85,928,537 L16P probably damaging Het
Atp4a G A 7: 30,720,672 probably benign Het
Btnl10 G A 11: 58,923,825 V444M probably damaging Het
Camkv A T 9: 107,946,146 N124Y probably damaging Het
Catsperb T C 12: 101,575,916 L625P probably benign Het
Ccdc171 A G 4: 83,693,962 I973V probably benign Het
Celsr1 T C 15: 85,931,282 D1844G probably benign Het
Chd7 G C 4: 8,828,258 K1066N probably damaging Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Corin T C 5: 72,358,484 D409G probably benign Het
Cry1 T C 10: 85,146,724 probably null Het
Cttnbp2 T A 6: 18,427,690 probably benign Het
Dnah6 G T 6: 73,092,116 D2477E possibly damaging Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dopey1 C G 9: 86,545,288 R2164G probably damaging Het
Dsp A G 13: 38,184,038 T678A possibly damaging Het
Fam129a A G 1: 151,718,086 T841A probably benign Het
Fam49b T A 15: 63,943,207 T139S probably damaging Het
Farsb A C 1: 78,476,196 I51S probably damaging Het
Gm10220 T A 5: 26,117,932 I161L possibly damaging Het
Gm10782 G T 13: 56,363,174 noncoding transcript Het
Gm12830 A T 4: 114,845,051 T137S unknown Het
Gopc A G 10: 52,358,846 L67P probably damaging Het
Hmcn1 T C 1: 150,675,540 I2655V probably benign Het
Hmcn2 C T 2: 31,393,054 Q1981* probably null Het
Ifi209 T A 1: 173,641,074 S157T probably benign Het
Iqcf1 A T 9: 106,501,908 I74F probably damaging Het
Irf3 A T 7: 44,999,958 R78W probably damaging Het
Kank4 T C 4: 98,774,785 D722G probably benign Het
Loxl1 A G 9: 58,290,782 V597A possibly damaging Het
Marveld1 T C 19: 42,147,833 L62P probably damaging Het
Mga T G 2: 119,916,626 D419E possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mroh2b A G 15: 4,908,981 K251E possibly damaging Het
Myh4 A G 11: 67,251,818 E935G probably damaging Het
Nat8f2 C A 6: 85,868,012 A123S possibly damaging Het
Olfr1423 G A 19: 12,035,828 L305F probably benign Het
Pcdha9 T A 18: 36,998,103 V75E probably damaging Het
Pebp4 A T 14: 69,963,542 probably null Het
Pitx1 A G 13: 55,826,353 S222P probably benign Het
Plekhg3 G A 12: 76,578,400 V1339M possibly damaging Het
Plekhs1 C T 19: 56,479,828 S276L possibly damaging Het
Plin4 T C 17: 56,104,932 T700A possibly damaging Het
Plxnb2 T C 15: 89,164,209 probably null Het
Pms2 T C 5: 143,928,125 I675T probably damaging Het
Polrmt A G 10: 79,742,054 L268P probably damaging Het
Rtp1 A G 16: 23,429,275 T33A probably benign Het
Safb2 T C 17: 56,575,346 probably benign Het
Sdk1 C A 5: 142,100,186 P1383Q probably damaging Het
Setdb1 A T 3: 95,337,258 C758S probably damaging Het
Sh3gl2 T C 4: 85,398,923 probably benign Het
Slc13a2 G A 11: 78,404,822 probably benign Het
Slc35b1 T C 11: 95,387,805 Y126H probably damaging Het
Strip2 C A 6: 29,917,155 probably benign Het
Tbx4 A G 11: 85,914,404 T440A probably damaging Het
Tcf7l2 C A 19: 55,919,508 probably null Het
Tgfb1 A C 7: 25,688,149 D94A probably benign Het
Tmem132b T C 5: 125,787,733 C968R probably damaging Het
Tmem176b T A 6: 48,834,533 M61L probably benign Het
Tmem258 A G 19: 10,207,325 probably null Het
Tpr T C 1: 150,426,888 L1379S probably benign Het
Ttc26 T G 6: 38,389,122 C124W probably benign Het
Vmn2r44 T C 7: 8,380,124 D157G possibly damaging Het
Wfdc8 T C 2: 164,597,729 I244M probably benign Het
Zfp341 T C 2: 154,625,001 S97P probably benign Het
Zfp655 T C 5: 145,243,635 V101A probably benign Het
Zfp788 T C 7: 41,649,853 S586P probably damaging Het
Zfp874b C T 13: 67,481,254 V52I possibly damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49851467 missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 49939553 missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 49917668 missense probably benign 0.00
IGL00969:Dmxl1 APN 18 49912725 missense probably benign 0.02
IGL01113:Dmxl1 APN 18 49912751 missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49857334 missense probably benign
IGL01475:Dmxl1 APN 18 49871714 missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 49920938 missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 49962205 missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49863025 missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49864868 missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 49878382 nonsense probably null
IGL01933:Dmxl1 APN 18 49877785 missense probably benign 0.17
IGL01952:Dmxl1 APN 18 49890654 missense probably benign 0.11
IGL02120:Dmxl1 APN 18 49894178 missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 49961163 missense probably benign 0.00
IGL02213:Dmxl1 APN 18 49877674 splice site probably benign
IGL02261:Dmxl1 APN 18 49840499 missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49864895 missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49859120 missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 49878180 missense probably benign 0.01
IGL03258:Dmxl1 APN 18 49920893 missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49864818 missense probably benign
R0001:Dmxl1 UTSW 18 49888897 splice site probably benign
R0027:Dmxl1 UTSW 18 49957295 splice site probably benign
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49864035 missense probably benign 0.03
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0046:Dmxl1 UTSW 18 49878082 missense probably benign 0.22
R0257:Dmxl1 UTSW 18 49955803 splice site probably benign
R0349:Dmxl1 UTSW 18 49879282 missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 49879362 missense probably benign 0.14
R0511:Dmxl1 UTSW 18 49891467 nonsense probably null
R0539:Dmxl1 UTSW 18 49857430 splice site probably benign
R0542:Dmxl1 UTSW 18 49893694 missense probably benign 0.05
R0587:Dmxl1 UTSW 18 49935307 missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49851423 splice site probably benign
R0744:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49833148 missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 49893402 missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 49893611 missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 49893225 missense probably benign
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 49878483 missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 49888853 missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49857249 missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49852367 missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49859286 critical splice donor site probably null
R1638:Dmxl1 UTSW 18 49890767 nonsense probably null
R1646:Dmxl1 UTSW 18 49962261 missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 49934637 missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 49893444 nonsense probably null
R1732:Dmxl1 UTSW 18 49902988 missense probably benign
R1886:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49859135 missense probably benign 0.09
R1895:Dmxl1 UTSW 18 49955914 splice site probably null
R1911:Dmxl1 UTSW 18 49878163 missense probably benign 0.00
R2020:Dmxl1 UTSW 18 49889558 nonsense probably null
R2116:Dmxl1 UTSW 18 49878817 missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 49917631 missense probably benign 0.00
R2206:Dmxl1 UTSW 18 49894094 missense probably benign 0.12
R2216:Dmxl1 UTSW 18 49893923 missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49846639 missense probably benign 0.34
R2333:Dmxl1 UTSW 18 49919976 splice site probably null
R2343:Dmxl1 UTSW 18 49890678 missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 49880791 missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 49935317 missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49865122 missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 49878259 missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49863962 missense probably benign
R4033:Dmxl1 UTSW 18 49851431 missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 49961197 missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 49878017 nonsense probably null
R4406:Dmxl1 UTSW 18 49889553 missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49848761 missense probably benign
R4454:Dmxl1 UTSW 18 49893332 missense probably benign 0.01
R4459:Dmxl1 UTSW 18 49961216 missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49852360 missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 49962181 missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 49878631 missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 49878021 missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49862992 missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49851476 missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 49889467 missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 49957281 intron probably benign
R4885:Dmxl1 UTSW 18 49878795 missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 49895127 missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 49870923 missense probably benign 0.00
R5177:Dmxl1 UTSW 18 49893584 missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 49951235 missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49863119 critical splice donor site probably null
R5433:Dmxl1 UTSW 18 49867899 splice site probably null
R5598:Dmxl1 UTSW 18 49864478 missense probably benign 0.04
R5633:Dmxl1 UTSW 18 49877697 missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 49891626 missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 49894257 missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 49931941 nonsense probably null
R5706:Dmxl1 UTSW 18 49957395 critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49846586 missense probably benign
R5876:Dmxl1 UTSW 18 49870984 missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49857386 missense probably benign 0.00
R6145:Dmxl1 UTSW 18 49912766 missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 49893335 missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49863015 missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 49902367 missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 49871732 missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49846586 missense probably benign
R6319:Dmxl1 UTSW 18 49852300 missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49864578 missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49859179 missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 49878246 missense probably benign 0.03
R6743:Dmxl1 UTSW 18 49880780 missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 49893974 missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 49921024 missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 49955823 missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49852288 nonsense probably null
R6857:Dmxl1 UTSW 18 49864835 missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 49935305 missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49843784 critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 49920902 missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49851495 missense probably null 0.99
R6897:Dmxl1 UTSW 18 49863057 missense possibly damaging 0.51
R6917:Dmxl1 UTSW 18 49864148 missense probably damaging 1.00
X0025:Dmxl1 UTSW 18 49864368 missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 49919899 missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 49920965 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCTAGCTATCCTCAAACTCTAG -3'
(R):5'- AAGGGGCATCAACTGGTTTC -3'

Sequencing Primer
(F):5'- AGTGTATTTCCGAATTTCTGAAGTG -3'
(R):5'- GGTTTCTTCCACTGTAGTACACATG -3'
Posted On2017-08-08