Incidental Mutation 'R1411:Tfip11'
ID200800
Institutional Source Beutler Lab
Gene Symbol Tfip11
Ensembl Gene ENSMUSG00000029345
Gene Nametuftelin interacting protein 11
SynonymsTip39
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1411 (G1)
Quality Score103
Status Validated
Chromosome5
Chromosomal Location112326358-112338073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112333033 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 292 (V292L)
Ref Sequence ENSEMBL: ENSMUSP00000031288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000129528] [ENSMUST00000146510] [ENSMUST00000198238]
Predicted Effect probably benign
Transcript: ENSMUST00000031288
AA Change: V292L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: V292L

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126736
Predicted Effect probably benign
Transcript: ENSMUST00000129528
SMART Domains Protein: ENSMUSP00000115225
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
Pfam:TIP_N 15 70 9.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect probably benign
Transcript: ENSMUST00000198238
SMART Domains Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
G_patch 8 54 1.9e-20 SMART
low complexity region 72 78 N/A INTRINSIC
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flt1 C T 5: 147,580,316 V1054M probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Tfip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tfip11 APN 5 112329503 missense possibly damaging 0.51
IGL02627:Tfip11 APN 5 112329813 missense possibly damaging 0.69
R0023:Tfip11 UTSW 5 112332009 missense possibly damaging 0.47
R0254:Tfip11 UTSW 5 112335655 missense probably benign 0.06
R0465:Tfip11 UTSW 5 112333264 missense probably benign 0.32
R0569:Tfip11 UTSW 5 112328094 missense probably damaging 1.00
R1751:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1767:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1792:Tfip11 UTSW 5 112329397 missense possibly damaging 0.95
R2125:Tfip11 UTSW 5 112335663 missense possibly damaging 0.46
R4781:Tfip11 UTSW 5 112333399 missense probably damaging 0.99
R4975:Tfip11 UTSW 5 112335747 unclassified probably benign
R5348:Tfip11 UTSW 5 112335668 missense probably benign 0.01
R5385:Tfip11 UTSW 5 112331220 critical splice donor site probably null
R5469:Tfip11 UTSW 5 112334325 nonsense probably null
R6540:Tfip11 UTSW 5 112334397 unclassified probably null
R6810:Tfip11 UTSW 5 112333597 missense probably benign 0.07
R7199:Tfip11 UTSW 5 112331178 missense probably benign 0.16
R7342:Tfip11 UTSW 5 112327972 start codon destroyed probably null 0.99
R7352:Tfip11 UTSW 5 112333268 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGACAGCTCAAGCCTGTGGTAG -3'
(R):5'- ACGCTCCTCATGTGCAAGAACCTC -3'

Sequencing Primer
(F):5'- GTAGGCAGCTCTGTCCATC -3'
(R):5'- TCTCCAGCTCGTGTGACAG -3'
Posted On2014-05-23