Incidental Mutation 'R1411:Flt1'
ID200803
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 039467-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1411 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147580316 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1054 (V1054M)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: V1054M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: V1054M

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,730 I85F probably damaging Het
Acp4 A G 7: 44,256,843 probably benign Het
Baz1b T C 5: 135,230,323 F1080L possibly damaging Het
Cbx5 A T 15: 103,213,120 M30K probably benign Het
Cdc73 A G 1: 143,609,514 probably benign Het
Cdcp1 A T 9: 123,190,112 L34Q probably damaging Het
Chd8 C T 14: 52,224,646 V738I probably benign Het
Cpeb2 T G 5: 43,233,770 probably benign Het
Cyp2c67 T A 19: 39,638,591 D265V probably damaging Het
Cyp2j11 A G 4: 96,345,216 I81T probably benign Het
Dbx2 T C 15: 95,632,381 E235G probably damaging Het
Dgkq C A 5: 108,650,362 V677F probably damaging Het
Ercc5 A G 1: 44,178,281 N928S probably damaging Het
Flywch1 T C 17: 23,755,824 D614G probably damaging Het
Frmd3 T C 4: 74,153,621 F247L probably damaging Het
Gm1527 A G 3: 28,914,483 N228S probably benign Het
Gm8979 C T 7: 106,083,479 A190T probably benign Het
Gpld1 T A 13: 24,962,808 L251Q probably damaging Het
Gzma C T 13: 113,096,208 V117I probably benign Het
Hydin C A 8: 110,575,031 T3798K probably benign Het
Il1rapl1 T A X: 86,747,298 S679C possibly damaging Het
Lrrc8c G A 5: 105,608,179 A607T probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mfsd4b4 A T 10: 39,892,140 M319K probably damaging Het
Mroh2b A C 15: 4,918,317 H538P probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup188 A G 2: 30,343,795 T1733A probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Ofcc1 A G 13: 40,142,787 S524P probably benign Het
Olfr986 C T 9: 40,187,139 T8I possibly damaging Het
Padi4 C T 4: 140,752,603 S413N probably damaging Het
Pdzrn4 A G 15: 92,771,013 *1015W probably null Het
Pkhd1 G A 1: 20,373,896 P2314L probably damaging Het
Serpinb9c C G 13: 33,151,834 V212L probably benign Het
Slc25a23 A G 17: 57,059,622 F18L probably damaging Het
Smarca4 C A 9: 21,658,955 N751K probably damaging Het
Tfip11 G T 5: 112,333,033 V292L probably benign Het
Tnrc18 T C 5: 142,765,947 K1201R unknown Het
Vmn1r199 T C 13: 22,383,501 F322L probably benign Het
Vmn1r201 T C 13: 22,474,679 V21A probably benign Het
Vmn2r108 A T 17: 20,462,845 I699K probably damaging Het
Vmn2r117 T C 17: 23,460,553 N566D probably damaging Het
Wdr12 A T 1: 60,088,072 D141E probably benign Het
Zfp974 A G 7: 27,911,209 S364P probably benign Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTCAGCACACAGCTCTTCTGGAC -3'
(R):5'- AGAGATGCTCCCTCTACCACAGATG -3'

Sequencing Primer
(F):5'- GGACCATCTATCTTCGCAGAG -3'
(R):5'- GGCAGCGAGAAACATCCTTT -3'
Posted On2014-05-23