Incidental Mutation 'R1824:Begain'
ID206700
Institutional Source Beutler Lab
Gene Symbol Begain
Ensembl Gene ENSMUSG00000040867
Gene Namebrain-enriched guanylate kinase-associated
SynonymsLOC380785
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1824 (G1)
Quality Score88
Status Not validated
Chromosome12
Chromosomal Location109032187-109068217 bp(-) (GRCm38)
Type of Mutationunclassified (4651 bp from exon)
DNA Base Change (assembly) A to G at 109033099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000167816] [ENSMUST00000190647] [ENSMUST00000209829] [ENSMUST00000221510]
Predicted Effect probably null
Transcript: ENSMUST00000047115
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073156
AA Change: M582T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072899
Gene: ENSMUSG00000040867
AA Change: M582T

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167816
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189236
Predicted Effect probably damaging
Transcript: ENSMUST00000190647
AA Change: M582T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140393
Gene: ENSMUSG00000040867
AA Change: M582T

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209829
AA Change: M787T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000221510
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Begain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Begain APN 12 109033645 missense probably benign 0.00
IGL02027:Begain APN 12 109034309 missense possibly damaging 0.80
IGL02186:Begain APN 12 109033352 missense probably damaging 1.00
IGL02219:Begain APN 12 109033730 missense probably benign 0.01
IGL02555:Begain APN 12 109034189 missense probably damaging 1.00
FR4342:Begain UTSW 12 109033418 unclassified probably benign
R0335:Begain UTSW 12 109038934 missense probably damaging 1.00
R1815:Begain UTSW 12 109034107 missense probably damaging 1.00
R1837:Begain UTSW 12 109035323 splice site probably benign
R1839:Begain UTSW 12 109035323 splice site probably benign
R2110:Begain UTSW 12 109033917 nonsense probably null
R2849:Begain UTSW 12 109033118 missense probably benign 0.17
R4480:Begain UTSW 12 109034123 missense probably damaging 1.00
R4692:Begain UTSW 12 109033892 missense probably damaging 1.00
R6425:Begain UTSW 12 109033394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAACTGGAACTGGACTTCC -3'
(R):5'- TAGTTTCTCGGAGGGCGATGAC -3'

Sequencing Primer
(F):5'- AACTGGAACTGGACTTCCTTGGC -3'
(R):5'- CTGTCTCAGGGTCATCTGGC -3'
Posted On2014-06-23