Incidental Mutation 'R1824:Clip2'
ID206656
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene NameCAP-GLY domain containing linker protein 2
SynonymsWSCR4, Cyln2, CLIP-115
MMRRC Submission 039852-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R1824 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134489383-134552434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134503227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 540 (Y540H)
Ref Sequence ENSEMBL: ENSMUSP00000037431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
Predicted Effect probably benign
Transcript: ENSMUST00000036999
AA Change: Y540H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: Y540H

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100647
AA Change: Y575H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: Y575H

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T C 10: 70,872,256 noncoding transcript Het
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abl1 T A 2: 31,800,644 M706K probably benign Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Acd A G 8: 105,700,490 L96P probably damaging Het
Arsi T A 18: 60,912,297 W20R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asic3 C T 5: 24,413,751 Q14* probably null Het
Asxl3 T A 18: 22,522,068 I1045N probably damaging Het
Atr T C 9: 95,936,421 I2149T probably damaging Het
Begain A G 12: 109,033,099 probably null Het
Brca2 C T 5: 150,536,922 T554I possibly damaging Het
C130079G13Rik C A 3: 59,932,580 Y24* probably null Het
C1s2 C T 6: 124,635,682 V11I probably benign Het
Cacna1i T C 15: 80,376,789 F1333L possibly damaging Het
Camsap2 T C 1: 136,273,783 T662A possibly damaging Het
Cep164 C T 9: 45,778,928 V1367M probably damaging Het
Cfap46 C A 7: 139,639,602 A1316S probably benign Het
Cic T C 7: 25,288,266 S553P probably damaging Het
Clcn2 C T 16: 20,715,962 A12T probably benign Het
Coil A G 11: 88,982,097 N428S possibly damaging Het
Cpxm1 A C 2: 130,395,697 V196G probably damaging Het
Cr2 A G 1: 195,157,316 V601A probably damaging Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Dclre1a T C 19: 56,546,718 probably null Het
Dennd4a G C 9: 64,859,358 probably null Het
Dlg5 T C 14: 24,149,444 H1464R probably benign Het
Dmac2 T G 7: 25,624,792 M225R probably damaging Het
Dnah8 T C 17: 30,731,180 V1991A possibly damaging Het
Dscam A C 16: 96,825,581 V376G probably benign Het
Dync1li1 A G 9: 114,709,184 D203G probably benign Het
Eva1c A G 16: 90,866,443 T22A probably benign Het
Fam110b A G 4: 5,799,029 D149G probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Fsip1 T C 2: 118,232,908 D360G probably damaging Het
Galnt14 T C 17: 73,709,939 T41A probably benign Het
Gdf3 T A 6: 122,609,962 Q2L probably benign Het
Glrp1 A G 1: 88,509,789 probably null Het
Gm3336 C G 8: 70,720,417 probably null Het
Gm8674 C T 13: 49,900,808 noncoding transcript Het
Gnat1 A G 9: 107,676,575 Y226H probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
H1foo A G 6: 115,948,758 Y1C probably null Het
Ick T A 9: 78,157,862 D351E probably benign Het
Igfbpl1 C A 4: 45,826,406 A130S probably benign Het
Impdh1 T A 6: 29,205,088 D261V probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jcad A G 18: 4,649,293 T55A probably benign Het
Jup G A 11: 100,374,137 R663* probably null Het
Kalrn C T 16: 34,294,215 G556D probably damaging Het
Krt81 T C 15: 101,460,139 E411G probably damaging Het
Lcat T C 8: 105,939,888 E334G probably damaging Het
Lhcgr T C 17: 88,750,157 E302G probably benign Het
Magi1 A G 6: 93,699,639 V913A possibly damaging Het
Mrpl19 A T 6: 81,964,079 probably null Het
Muc4 G T 16: 32,755,933 probably benign Het
Mycbp2 A G 14: 103,252,509 V953A possibly damaging Het
Myo3a G A 2: 22,396,243 V600I probably benign Het
Ndufv3 G A 17: 31,531,245 R467Q probably damaging Het
Ngef A G 1: 87,503,264 probably null Het
Nisch A T 14: 31,176,432 probably benign Het
Nlrp4c G A 7: 6,066,956 probably null Het
Nup153 A T 13: 46,713,747 S154T probably damaging Het
Obscn A G 11: 58,994,832 probably benign Het
Olfr1247 G T 2: 89,609,349 P251H probably damaging Het
Olfr31 T A 14: 14,328,774 L221Q probably damaging Het
Olfr818 T C 10: 129,945,337 M242V possibly damaging Het
Otogl T C 10: 107,779,831 N1869S probably benign Het
Phf24 G T 4: 42,934,661 C136F probably damaging Het
Phldb2 A T 16: 45,826,011 V65E probably benign Het
Pkhd1 C A 1: 20,347,457 G2490V probably damaging Het
Prl8a8 A T 13: 27,508,450 M186K probably damaging Het
Qars T C 9: 108,514,610 V70A probably damaging Het
Rac1 C T 5: 143,517,225 V14I probably benign Het
Rapgef5 T A 12: 117,688,684 probably null Het
Slc16a12 G A 19: 34,670,878 T405M possibly damaging Het
Slc17a6 A G 7: 51,661,546 Y336C probably damaging Het
Slc30a9 T C 5: 67,348,052 L441P probably damaging Het
Slc45a2 T C 15: 11,022,086 S305P probably damaging Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Sp1 T G 15: 102,431,003 S773A possibly damaging Het
Spen C A 4: 141,472,785 G2821C probably damaging Het
Tagap1 A G 17: 6,956,026 S424P probably benign Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Tfec C T 6: 16,840,468 probably null Het
Thsd7a A T 6: 12,409,042 probably null Het
Tnfsf15 C A 4: 63,733,351 G112V probably benign Het
Tnfsf9 A G 17: 57,105,738 T103A probably benign Het
Tnxb C T 17: 34,692,333 R1537* probably null Het
Tpra1 A G 6: 88,911,823 N329S probably benign Het
Ttc12 A G 9: 49,456,884 F281S probably damaging Het
Unc79 A G 12: 103,059,320 N322S probably damaging Het
Unk G T 11: 116,030,442 probably benign Het
Usp4 G T 9: 108,348,008 G31W probably damaging Het
Vcan G T 13: 89,705,212 A543D possibly damaging Het
Vil1 A C 1: 74,418,447 I80L probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Vpreb1 A G 16: 16,869,071 probably null Het
Zbtb6 C T 2: 37,429,817 C33Y probably damaging Het
Zfp330 A T 8: 82,766,015 C189* probably null Het
Zfp942 T A 17: 21,928,541 H369L probably damaging Het
Zfp943 T A 17: 21,992,380 I149K probably benign Het
Zfyve19 G A 2: 119,211,535 V162M probably benign Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R0519:Clip2 UTSW 5 134516151 missense probably benign 0.01
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3892:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R4741:Clip2 UTSW 5 134516269 missense probably benign 0.02
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
R7032:Clip2 UTSW 5 134522630 missense probably damaging 1.00
R7152:Clip2 UTSW 5 134496241 missense not run
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TACCAGGGCCTTCAACTCTC -3'
(R):5'- ACAGTGGCTGAGAAGTCTCG -3'

Sequencing Primer
(F):5'- AGAGTTCAGCGTGGCCTTCAG -3'
(R):5'- AGAAGTCTCGGGTGCTGCAG -3'
Posted On2014-06-23