Incidental Mutation 'R1848:Dync2h1'
ID207908
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 039873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1848 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7049166 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 3245 (T3245S)
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: T3245S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: T3245S

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: T3245S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: T3245S

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: T3245S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: T3245S

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C A 8: 87,568,493 Y86* probably null Het
Aadac A G 3: 60,039,697 E272G probably damaging Het
Abcc8 A T 7: 46,166,902 D271E probably benign Het
Acan T C 7: 79,099,035 F1185L probably benign Het
Adam1a A T 5: 121,519,620 C537S probably damaging Het
Ago2 A G 15: 73,123,965 V395A probably benign Het
Alox15 A G 11: 70,350,752 V101A probably damaging Het
Ankra2 T C 13: 98,271,124 I194T probably damaging Het
Apobec4 C A 1: 152,756,230 P3H probably damaging Het
Arid3b G T 9: 57,796,677 Y329* probably null Het
Atm A T 9: 53,468,012 S1993T probably benign Het
Bpgm T G 6: 34,487,734 S129A probably benign Het
Brat1 A G 5: 140,718,509 D839G possibly damaging Het
Ccdc15 A T 9: 37,342,570 S128T probably benign Het
Cd300lg A T 11: 102,046,206 probably benign Het
Cdc34b C A 11: 94,742,477 Q168K probably damaging Het
Celsr2 A T 3: 108,401,310 V1767E probably benign Het
Cep350 T C 1: 155,953,651 D169G probably benign Het
Col7a1 A T 9: 108,969,565 D1762V possibly damaging Het
Coro7 A G 16: 4,630,434 L724P probably damaging Het
Crb1 T A 1: 139,237,012 I1125F probably damaging Het
Ctif T A 18: 75,519,941 D415V probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs2 A G 14: 55,240,841 D237G probably benign Het
Dhx9 T C 1: 153,465,753 Q582R probably damaging Het
Dnajc1 C T 2: 18,219,713 R443Q probably damaging Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dpf2 C A 19: 5,906,615 Q70H probably damaging Het
Dqx1 T A 6: 83,066,107 D608E probably damaging Het
Ect2l A G 10: 18,200,033 L35P probably damaging Het
Efcab5 A T 11: 77,103,306 L1285Q probably damaging Het
Eif4g1 G C 16: 20,681,867 R697P probably damaging Het
Emsy T A 7: 98,600,821 E753V probably damaging Het
Entpd3 A G 9: 120,558,419 I227M probably damaging Het
Epn1 T A 7: 5,089,998 V103E probably damaging Het
Esrra T C 19: 6,912,010 D337G probably benign Het
Fam129c T C 8: 71,603,769 M371T possibly damaging Het
Fam83e A T 7: 45,728,769 K406* probably null Het
Fam83e A T 7: 45,728,770 K406M possibly damaging Het
Fat2 A G 11: 55,311,558 I230T probably damaging Het
Fbxl16 A G 17: 25,816,446 I6V probably benign Het
Fgf23 T C 6: 127,073,193 I55T probably damaging Het
Fibcd1 T A 2: 31,821,549 D288V probably damaging Het
Flnb T C 14: 7,892,113 I594T probably damaging Het
Gabbr2 T C 4: 46,739,823 E449G probably benign Het
Gbf1 T G 19: 46,272,037 S1130A possibly damaging Het
Gipc3 T C 10: 81,341,265 E157G probably damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm6625 A C 8: 89,146,834 noncoding transcript Het
Gpx4 A G 10: 80,056,036 probably benign Het
Grb10 A G 11: 11,946,029 F264L possibly damaging Het
Grik3 T C 4: 125,694,138 Y684H probably damaging Het
Gstp1 C T 19: 4,036,795 probably benign Het
Haus8 G A 8: 71,256,123 probably benign Het
Hip1 G A 5: 135,435,141 probably null Het
Hist3h2ba A T 11: 58,949,102 I55F possibly damaging Het
Hspbap1 T A 16: 35,818,764 probably null Het
Htr2b T A 1: 86,099,429 I452F possibly damaging Het
Hydin T A 8: 110,569,808 H3656Q probably benign Het
Klb T A 5: 65,348,837 D142E probably benign Het
Lamb3 A T 1: 193,334,616 T777S possibly damaging Het
Lins1 C A 7: 66,714,322 T650K probably damaging Het
Loxhd1 A G 18: 77,281,971 K5R possibly damaging Het
Lpp G A 16: 24,761,655 M40I probably damaging Het
Mia2 A T 12: 59,170,251 probably benign Het
Miip A C 4: 147,863,092 F204V probably damaging Het
Mmp21 T C 7: 133,677,153 R323G probably benign Het
Mta3 T A 17: 83,755,551 probably benign Het
Myh1 A G 11: 67,213,630 K1004R probably benign Het
Myh14 T A 7: 44,632,429 I810F probably damaging Het
Nbas A C 12: 13,413,597 D1295A probably damaging Het
Npr2 T G 4: 43,632,384 V67G probably benign Het
Oas1f C A 5: 120,855,429 Q235K probably damaging Het
Olfr109 T A 17: 37,467,047 S280R probably damaging Het
Olfr59 G T 11: 74,289,213 C189F probably damaging Het
Olfr60 T A 7: 140,345,987 M1L probably benign Het
Olfr629 T C 7: 103,741,174 N22S probably benign Het
Olfr857 C T 9: 19,713,090 H88Y probably benign Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pde1b A G 15: 103,525,340 probably null Het
Pdilt T C 7: 119,489,384 T465A probably benign Het
Plxnd1 T C 6: 115,966,546 H1233R probably damaging Het
Ppm1b T A 17: 84,994,124 M144K probably benign Het
Prkdc T C 16: 15,808,058 L3316S probably benign Het
Prm2 T A 16: 10,791,591 probably benign Het
Prmt7 T C 8: 106,237,008 V240A probably benign Het
Prx C A 7: 27,518,888 A938E possibly damaging Het
Rbm7 A G 9: 48,490,894 V131A probably benign Het
Ric1 T A 19: 29,600,813 probably null Het
Rnf150 A T 8: 82,864,010 M1L possibly damaging Het
Rnf20 C T 4: 49,644,628 R298W probably damaging Het
Rp1 T A 1: 4,347,232 Y1219F possibly damaging Het
Scn7a A G 2: 66,684,013 probably null Het
Sdad1 A G 5: 92,292,651 probably null Het
Sept9 T C 11: 117,353,083 probably benign Het
Serinc3 T C 2: 163,645,489 probably benign Het
Shc3 C T 13: 51,461,388 G178R probably damaging Het
Slc4a10 A T 2: 62,316,606 K1090M probably damaging Het
Slco1a1 T C 6: 141,923,111 I376V probably benign Het
Slmap A T 14: 26,422,574 F719L probably benign Het
Smgc A G 15: 91,859,758 N573D possibly damaging Het
Spx G A 6: 142,414,079 probably null Het
Srrt C G 5: 137,296,945 E308Q probably damaging Het
Tas2r130 T A 6: 131,630,597 R78S probably benign Het
Tchhl1 A G 3: 93,471,101 R371G probably damaging Het
Teddm2 C T 1: 153,850,448 A174T probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trim33 T C 3: 103,324,640 probably benign Het
Tspan31 A G 10: 127,069,458 V40A probably damaging Het
Uevld A G 7: 46,945,227 probably benign Het
Vcl G T 14: 21,008,995 A560S probably benign Het
Vmn2r24 T A 6: 123,816,224 C837S probably damaging Het
Vmn2r57 C T 7: 41,428,107 V212M probably damaging Het
Vps13c A G 9: 67,936,340 T1968A probably benign Het
Vtn A G 11: 78,500,567 R269G probably damaging Het
Wdcp G A 12: 4,850,245 V34I possibly damaging Het
Zc3h14 A G 12: 98,752,832 D152G possibly damaging Het
Zfp189 C T 4: 49,529,266 P123L probably benign Het
Zfp318 T C 17: 46,406,055 S1038P possibly damaging Het
Zfp873 A G 10: 82,060,572 D416G probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGAGATGAATCAGGGTTCTCTAC -3'
(R):5'- CACATTTTAGAAAGCTTTCTCCCAC -3'

Sequencing Primer
(F):5'- TGAGTGTTCTATCATTTAAAAAGGCC -3'
(R):5'- CTGTCAAGTGCTGATCAC -3'
Posted On2014-06-23