Incidental Mutation 'R1850:Dync2h1'
ID208004
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 039874-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1850 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7001448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3854 (T3854A)
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: T3847A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: T3847A

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: T3847A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: T3847A

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: T3854A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: T3854A

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik T C 19: 28,939,171 probably null Het
6030419C18Rik A T 9: 58,499,109 M101L probably benign Het
Adam28 T A 14: 68,639,195 Q202L probably benign Het
Adgb C A 10: 10,442,502 V199F probably damaging Het
Aff1 G T 5: 103,833,907 R645S probably damaging Het
Aoc1 C T 6: 48,905,268 S48F probably benign Het
Atf6 A T 1: 170,819,286 N339K probably damaging Het
Bpifb3 C G 2: 153,929,344 S392C possibly damaging Het
Camk1d T C 2: 5,362,015 M130V probably benign Het
Ces1a T A 8: 93,027,326 N350Y probably damaging Het
Cfap57 G A 4: 118,599,894 R453C probably damaging Het
Chd4 T A 6: 125,121,656 N1532K probably damaging Het
Chd5 T C 4: 152,370,533 L824P probably damaging Het
Ckap5 G A 2: 91,595,713 R1306H probably damaging Het
Crybg1 A G 10: 43,997,674 F1146S probably damaging Het
Dusp12 G A 1: 170,880,629 T173M probably benign Het
Echdc1 A T 10: 29,344,603 I252F probably damaging Het
Emc1 A T 4: 139,359,373 probably benign Het
Fbn2 C A 18: 58,039,305 probably benign Het
Fsip2 T A 2: 82,984,589 N3555K possibly damaging Het
Gabra1 T A 11: 42,179,576 T20S probably benign Het
H2afy T C 13: 56,096,239 probably benign Het
Igf1 A C 10: 87,861,374 T2P possibly damaging Het
Jcad C A 18: 4,675,730 T1164N possibly damaging Het
Kalrn A T 16: 33,975,923 S2830T probably damaging Het
Lepr C A 4: 101,733,423 A66E possibly damaging Het
Lmntd1 T A 6: 145,413,480 M315L probably benign Het
Lrch3 A G 16: 32,986,793 T479A probably benign Het
Matr3 A G 18: 35,582,057 N237D probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtif2 A G 11: 29,540,683 I462M probably benign Het
Nrip1 T C 16: 76,293,344 I442V probably damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr1415 T A 1: 92,491,402 M118L possibly damaging Het
Olfr741 G A 14: 50,485,598 A47T probably benign Het
Otogl T A 10: 107,878,064 Y498F probably damaging Het
Pbx3 A T 2: 34,176,820 F351I probably benign Het
Pcdh18 T C 3: 49,756,405 T154A probably benign Het
Pex5l A T 3: 32,950,876 probably null Het
Plec T C 15: 76,188,232 I718V probably benign Het
Pparg T A 6: 115,450,980 Y143N probably damaging Het
Prl2c5 A G 13: 13,185,792 I12V probably benign Het
Rcor3 T A 1: 192,120,111 Q246L probably benign Het
Rnf214 A T 9: 45,869,448 probably benign Het
S1pr5 A T 9: 21,244,129 S334T probably benign Het
Scg3 C T 9: 75,682,167 S35N possibly damaging Het
Sept5 A T 16: 18,625,210 L19Q probably damaging Het
Serpinb7 T C 1: 107,428,295 F16S probably damaging Het
Sipa1l3 A T 7: 29,339,126 S365R probably damaging Het
Slc27a1 T C 8: 71,580,703 probably null Het
Slc2a10 C A 2: 165,515,213 H264Q probably benign Het
Slc9a3 A G 13: 74,161,770 I526V probably benign Het
Smchd1 T C 17: 71,389,771 D1203G probably damaging Het
Sult1b1 A G 5: 87,520,841 W181R probably damaging Het
Supt6 A G 11: 78,219,877 probably benign Het
Tcf12 C A 9: 71,868,215 A418S probably damaging Het
Tesk1 C T 4: 43,443,576 R48C probably damaging Het
Tiam2 A G 17: 3,437,235 Q677R probably damaging Het
Tspan8 C T 10: 115,833,225 A55V probably damaging Het
Txndc11 T C 16: 11,088,404 N421D probably damaging Het
Vmn1r201 A G 13: 22,474,631 N5S probably benign Het
Vmn2r120 T A 17: 57,525,826 I118L probably benign Het
Vps13b A T 15: 35,674,959 probably benign Het
Wdfy3 A G 5: 101,894,999 V1962A probably damaging Het
Zswim8 C T 14: 20,710,747 R107* probably null Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGATGCTCACTGATTGGGTC -3'
(R):5'- GAATTATTTGGTGCAAGTCGTAAGG -3'

Sequencing Primer
(F):5'- ATGCTCACTGATTGGGTCACATG -3'
(R):5'- TGAAGTAACAGAAAACTACATTGAGC -3'
Posted On2014-06-23