Incidental Mutation 'R1940:Dync2h1'
ID213934
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 039958-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 7139159 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably null
Transcript: ENSMUST00000048417
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140466
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147056
Predicted Effect probably null
Transcript: ENSMUST00000147193
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGTCCTCTGAGAGACACCATTAC -3'
(R):5'- TGATCAGCTTCAAAGATGCCAG -3'

Sequencing Primer
(F):5'- TCTGAGAGACACCATTACTGCAAC -3'
(R):5'- CCCTAAATGAATTTTTGGAGGCATG -3'
Posted On2014-07-14