Incidental Mutation 'R1879:Pde8b'
ID211425
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 039900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1879 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95085215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 308 (I308N)
Ref Sequence ENSEMBL: ENSMUSP00000125191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000160957] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022192
AA Change: I308N

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: I308N

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067082
AA Change: I335N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: I335N

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159608
AA Change: I308N

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684
AA Change: I308N

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160957
SMART Domains Protein: ENSMUSP00000125115
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:Response_reg 30 148 5.7e-16 PFAM
Blast:PAS 165 188 1e-7 BLAST
Blast:HDc 266 327 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162153
AA Change: I250N

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: I250N

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162328
Predicted Effect probably benign
Transcript: ENSMUST00000162412
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172104
AA Change: I355N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: I355N

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,476 D268G possibly damaging Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Abce1 T C 8: 79,687,456 N542S probably benign Het
Abcf1 T A 17: 35,961,812 E260D probably benign Het
Ahcy A G 2: 155,064,152 probably null Het
Akap13 C T 7: 75,610,727 A1033V probably benign Het
Alkbh6 A G 7: 30,311,895 N46S probably damaging Het
Ankrd34c A C 9: 89,730,073 L72V probably damaging Het
Arf4 T A 14: 26,646,921 N25K probably damaging Het
Arhgef4 A G 1: 34,722,440 D259G unknown Het
Cavin1 C A 11: 100,970,210 G86V probably damaging Het
Ces1d G A 8: 93,189,498 T167I probably benign Het
Cfb T C 17: 34,860,560 I754V probably benign Het
Clcnkb C T 4: 141,407,819 R536H possibly damaging Het
Clpb T G 7: 101,706,483 S181R probably benign Het
Col1a1 T C 11: 94,951,225 M1366T unknown Het
Cped1 T A 6: 22,085,015 probably null Het
Crip1 G A 12: 113,153,332 C82Y probably damaging Het
Csmd3 T C 15: 47,657,519 T2810A possibly damaging Het
Cyp2b9 A T 7: 26,198,569 D266V probably damaging Het
Cyp46a1 A G 12: 108,353,126 D294G probably damaging Het
Dst A G 1: 34,188,843 E1514G probably benign Het
Dync1h1 A G 12: 110,624,636 E1046G probably benign Het
Eya2 T C 2: 165,664,806 V4A probably benign Het
Frem3 A T 8: 80,611,938 R287* probably null Het
Fuca2 T A 10: 13,507,256 C323S possibly damaging Het
Ggt7 T C 2: 155,514,787 E4G possibly damaging Het
Gli1 C T 10: 127,333,737 R383H probably damaging Het
Gm4559 C A 7: 142,274,261 V35F unknown Het
Gpm6a T A 8: 55,037,330 C14S probably damaging Het
Hcn2 A T 10: 79,726,189 I340F probably benign Het
Hdac9 T A 12: 34,390,333 D349V probably damaging Het
Krt34 T C 11: 100,038,292 D364G possibly damaging Het
Mon2 C T 10: 123,002,885 R1565H probably damaging Het
Myb T A 10: 21,141,977 M482L probably benign Het
Nckap1l A T 15: 103,464,601 I294F probably benign Het
Nr2e1 A G 10: 42,568,371 probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1282 A T 2: 111,335,463 I205N possibly damaging Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr398 T A 11: 73,984,542 D22V probably benign Het
Olfr652 T C 7: 104,564,911 V230A possibly damaging Het
Pdzd2 T C 15: 12,373,900 R2050G possibly damaging Het
Phc3 C A 3: 30,914,458 S840I probably damaging Het
Piezo2 T A 18: 63,113,960 Y327F probably damaging Het
Pnliprp1 A T 19: 58,744,084 I460F probably benign Het
Pphln1 T G 15: 93,424,046 D35E probably damaging Het
Prdm6 G A 18: 53,568,217 V360I probably damaging Het
Rab35 T A 5: 115,640,160 W62R probably damaging Het
Sct G T 7: 141,278,699 P70Q probably damaging Het
Sdf4 A G 4: 156,009,847 N328S probably damaging Het
Senp5 A T 16: 31,983,824 S488R probably damaging Het
Serpina3n A G 12: 104,408,954 E95G probably benign Het
Sfswap C T 5: 129,541,328 A442V probably benign Het
Sgcd T C 11: 47,355,241 I45V probably benign Het
Sgcg T C 14: 61,236,897 probably null Het
Slc39a12 G T 2: 14,444,057 V489L probably benign Het
Slc5a11 T A 7: 123,239,448 I96N possibly damaging Het
Slc6a12 A G 6: 121,347,423 D2G probably damaging Het
Slc8a1 T C 17: 81,648,013 D532G probably damaging Het
Smarcd3 C A 5: 24,593,021 C465F probably damaging Het
Smc1b T A 15: 85,092,067 Q813L probably benign Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sptan1 A T 2: 29,995,528 N715I probably damaging Het
Tas1r2 T A 4: 139,669,695 Y782N probably damaging Het
Thap3 A T 4: 151,983,136 C162S probably benign Het
Topaz1 T A 9: 122,749,619 D531E possibly damaging Het
Vmn1r25 C T 6: 57,978,927 A126T possibly damaging Het
Zfhx2 A G 14: 55,065,617 F1637L probably benign Het
Zfhx2 T C 14: 55,072,749 Y780C possibly damaging Het
Zfp513 T G 5: 31,200,423 K202T probably damaging Het
Zfp956 A T 6: 47,963,744 T346S probably benign Het
Zkscan1 C T 5: 138,097,148 A219V probably damaging Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R2892:Pde8b UTSW 13 95034259 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCCACATAAGACAGG -3'
(R):5'- CATGCTGGCTCTGACATTTATATGTG -3'

Sequencing Primer
(F):5'- GGCAAACCCTACTGTGTGTG -3'
(R):5'- CCACGATAGCATTGTAGTGGGTAC -3'
Posted On2014-06-30