Incidental Mutation 'R1926:Eln'
ID213430
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
MMRRC Submission 039944-MU
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134706567 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 787 (Y787*)
Ref Sequence ENSEMBL: ENSMUSP00000015138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect probably null
Transcript: ENSMUST00000015138
AA Change: Y787*
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675
AA Change: Y787*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202570
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1481:Eln UTSW 5 134706572 missense probably damaging 0.99
R1682:Eln UTSW 5 134703782 makesense probably null
R1741:Eln UTSW 5 134729184 missense unknown
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGCCATACCTCCACCTGG -3'
(R):5'- GAGTTCATTCCTAGCACCAGAG -3'

Sequencing Primer
(F):5'- AATGGCCTGGCTCCTAGGAC -3'
(R):5'- TTCATTCCTAGCACCAGAGAGAGAG -3'
Posted On2014-07-14