Incidental Mutation 'R0133:Tmc3'
ID21748
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0133 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83612473 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 586 (N586K)
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably damaging
Transcript: ENSMUST00000039317
AA Change: N586K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540
AA Change: N586K

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably damaging
Transcript: ENSMUST00000164944
AA Change: N586K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540
AA Change: N586K

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Eps8l2 C T 7: 141,362,207 P721S unknown Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R1775:Tmc3 UTSW 7 83612532 missense probably benign 0.39
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4229:Tmc3 UTSW 7 83597402 intron probably benign
R4635:Tmc3 UTSW 7 83585082 unclassified probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6436:Tmc3 UTSW 7 83598487 missense probably damaging 1.00
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6648:Tmc3 UTSW 7 83597543 missense probably damaging 1.00
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7030:Tmc3 UTSW 7 83616817 splice site probably null
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCATCATCCCTCTGGAATGTGC -3'
(R):5'- TGTGGAGTCTGTGAAAGGCCAAATC -3'

Sequencing Primer
(F):5'- CCTCTGGAATGTGCAGACTG -3'
(R):5'- TATTTGCCAAGGACTCCAAAGG -3'
Posted On2013-04-12