Incidental Mutation 'R0133:Eps8l2'
ID21752
Institutional Source Beutler Lab
Gene Symbol Eps8l2
Ensembl Gene ENSMUSG00000025504
Gene NameEPS8-like 2
Synonyms
MMRRC Submission 038418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0133 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location141338880-141363020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141362207 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 721 (P721S)
Ref Sequence ENSEMBL: ENSMUSP00000026577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577]
Predicted Effect unknown
Transcript: ENSMUST00000026577
AA Change: P721S
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: P721S

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210158
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T C 11: 103,105,388 S172P probably damaging Het
Akap6 A T 12: 53,139,471 K1223* probably null Het
Akna G A 4: 63,379,361 Q819* probably null Het
Ankrd2 T C 19: 42,044,071 V257A probably benign Het
Arap1 T A 7: 101,386,229 D30E probably damaging Het
Atp6v0d2 T C 4: 19,910,578 probably benign Het
Blm T A 7: 80,502,367 I611F possibly damaging Het
Ccng2 A G 5: 93,273,381 K250R probably benign Het
Cdhr3 A G 12: 33,092,752 L8P possibly damaging Het
Csf2rb T G 15: 78,339,004 probably benign Het
Ctbs A G 3: 146,457,468 I204V probably benign Het
Cxcl16 T A 11: 70,458,770 E76D possibly damaging Het
Dhx15 T C 5: 52,154,072 I689V possibly damaging Het
Dlk2 T C 17: 46,298,942 probably benign Het
Dnah2 A T 11: 69,421,009 M4452K probably damaging Het
Dok4 T A 8: 94,865,363 I280F probably benign Het
Dsc3 T C 18: 19,971,582 T563A probably damaging Het
Dsg1b C T 18: 20,404,878 A617V probably damaging Het
Evx2 T C 2: 74,659,082 D112G possibly damaging Het
Fam124a C A 14: 62,606,333 T430K possibly damaging Het
Fbrs C T 7: 127,489,610 probably benign Het
Fbxw14 T C 9: 109,274,579 T22A probably benign Het
Fmo5 T G 3: 97,645,636 V300G probably damaging Het
Gadl1 T C 9: 115,941,343 S75P probably benign Het
Galnt2 T G 8: 124,338,538 I469S probably benign Het
Gga3 T A 11: 115,588,979 probably benign Het
Gm10647 T C 9: 66,798,489 probably benign Het
Gm14180 C A 11: 99,734,217 C25F unknown Het
Grid2 A T 6: 64,320,132 D493V probably damaging Het
Gzmc T A 14: 56,232,297 Y182F possibly damaging Het
Hecw2 A C 1: 53,830,740 L1443R probably damaging Het
Igkv4-62 A G 6: 69,400,069 I32T probably benign Het
Ikzf1 T A 11: 11,741,015 probably null Het
Il27ra G A 8: 84,033,942 probably benign Het
Jmjd1c C A 10: 67,240,808 A2137D probably benign Het
Kcnc2 T C 10: 112,458,597 C579R probably damaging Het
Kdr T C 5: 75,951,838 T862A probably damaging Het
Kif17 T C 4: 138,278,245 S182P possibly damaging Het
Klf5 A T 14: 99,301,882 T164S probably benign Het
Ksr2 T G 5: 117,555,294 V269G possibly damaging Het
Mcm5 T A 8: 75,120,911 D445E probably damaging Het
Mlkl T C 8: 111,327,948 I186V probably damaging Het
Muc4 A T 16: 32,771,604 S3017C possibly damaging Het
Myo15 T C 11: 60,477,850 F479L possibly damaging Het
Myo6 A G 9: 80,273,975 probably benign Het
Myom1 T A 17: 71,047,787 V393E probably damaging Het
Nup98 T A 7: 102,139,652 probably null Het
Odf2l A G 3: 145,148,541 N383S probably damaging Het
Olfml3 A C 3: 103,737,026 probably null Het
Olfr1057 A T 2: 86,374,815 V199E possibly damaging Het
Olfr1494 T A 19: 13,749,988 I294N probably damaging Het
Olfr1537 A G 9: 39,238,011 Y141H probably benign Het
Olfr829 G A 9: 18,856,629 M1I probably null Het
Plxna4 A T 6: 32,197,074 D1195E probably benign Het
Ppp1r1a T A 15: 103,537,820 H20L probably damaging Het
Prdm4 A G 10: 85,910,221 probably null Het
Prom2 A G 2: 127,538,338 probably benign Het
Rasal3 T C 17: 32,403,383 M1V probably null Het
Rhoj A G 12: 75,394,420 probably null Het
Rnf40 C T 7: 127,596,860 probably null Het
Slc15a3 T C 19: 10,843,250 L77P probably damaging Het
Slc26a6 T C 9: 108,861,323 V586A possibly damaging Het
Slc30a10 T A 1: 185,455,173 L37Q probably damaging Het
Slc43a2 T A 11: 75,563,577 M316K probably benign Het
Smarcal1 T C 1: 72,632,851 F844L probably benign Het
Snx19 A G 9: 30,428,616 E350G possibly damaging Het
Tecta T A 9: 42,367,228 T995S probably benign Het
Tmc3 T G 7: 83,612,473 N586K probably damaging Het
Tmem107 T A 11: 69,072,413 probably benign Het
Tmem247 A G 17: 86,918,561 Q51R probably benign Het
Tmpo G T 10: 91,164,038 probably benign Het
Ubr5 T A 15: 37,996,571 T1894S probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Xirp2 T A 2: 67,517,124 H3236Q probably benign Het
Zfand4 G A 6: 116,314,739 D545N probably benign Het
Zkscan3 G T 13: 21,394,774 P155T possibly damaging Het
Other mutations in Eps8l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Eps8l2 APN 7 141357663 missense probably benign 0.06
IGL01444:Eps8l2 APN 7 141361375 splice site probably benign
IGL01467:Eps8l2 APN 7 141361601 missense probably damaging 1.00
IGL01803:Eps8l2 APN 7 141358230 missense probably benign
IGL02598:Eps8l2 APN 7 141354936 splice site probably benign
IGL02823:Eps8l2 APN 7 141342075 missense probably damaging 1.00
IGL03061:Eps8l2 APN 7 141357235 unclassified probably benign
IGL03112:Eps8l2 APN 7 141361736 missense probably damaging 1.00
IGL03251:Eps8l2 APN 7 141342962 missense probably damaging 1.00
R0057:Eps8l2 UTSW 7 141342971 missense probably benign 0.08
R0361:Eps8l2 UTSW 7 141356199 missense probably benign 0.05
R0409:Eps8l2 UTSW 7 141342980 missense probably damaging 1.00
R0611:Eps8l2 UTSW 7 141355733 missense probably damaging 1.00
R1487:Eps8l2 UTSW 7 141361618 missense probably benign
R1679:Eps8l2 UTSW 7 141361057 missense probably damaging 1.00
R1914:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1915:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1918:Eps8l2 UTSW 7 141361724 missense probably damaging 0.99
R2098:Eps8l2 UTSW 7 141355792 unclassified probably null
R2170:Eps8l2 UTSW 7 141342071 missense probably benign 0.02
R3429:Eps8l2 UTSW 7 141357919 critical splice donor site probably null
R3734:Eps8l2 UTSW 7 141357821 missense probably damaging 1.00
R4296:Eps8l2 UTSW 7 141358262 nonsense probably null
R4701:Eps8l2 UTSW 7 141357260 missense probably damaging 1.00
R4758:Eps8l2 UTSW 7 141360373 missense probably damaging 0.98
R5564:Eps8l2 UTSW 7 141356621 missense possibly damaging 0.94
R5567:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5570:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5735:Eps8l2 UTSW 7 141360377 missense probably damaging 1.00
R5893:Eps8l2 UTSW 7 141357624 missense probably damaging 1.00
R5905:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R5927:Eps8l2 UTSW 7 141356346 missense probably benign
R6028:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6248:Eps8l2 UTSW 7 141342102 missense probably damaging 0.99
R6631:Eps8l2 UTSW 7 141356202 missense probably damaging 1.00
R7152:Eps8l2 UTSW 7 141355765 missense possibly damaging 0.95
R7231:Eps8l2 UTSW 7 141360392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGCCAGCTCACGGTTCAGAAG -3'
(R):5'- AGGTGTAGCTAGGCTCATACACAGG -3'

Sequencing Primer
(F):5'- TTCCTGGAGGTGAGCAGC -3'
(R):5'- ATACACAGGACTCTGCCTGG -3'
Posted On2013-04-12