Incidental Mutation 'R0053:5730559C18Rik'
ID218405
Institutional Source Beutler Lab
Gene Symbol 5730559C18Rik
Ensembl Gene ENSMUSG00000041605
Gene NameRIKEN cDNA 5730559C18 gene
Synonyms
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0053 (G1)
Quality Score75
Status Validated
Chromosome1
Chromosomal Location136213531-136234264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136227550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 106 (V106I)
Ref Sequence ENSEMBL: ENSMUSP00000113785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120339] [ENSMUST00000144464] [ENSMUST00000150163] [ENSMUST00000153910] [ENSMUST00000195177]
Predicted Effect probably benign
Transcript: ENSMUST00000120339
AA Change: V106I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113785
Gene: ENSMUSG00000041605
AA Change: V106I

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Pfam:DUF3338 101 230 6.2e-57 PFAM
low complexity region 273 316 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
low complexity region 466 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144464
AA Change: V7I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115554
Gene: ENSMUSG00000041605
AA Change: V7I

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 5.7e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150163
AA Change: V7I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118074
Gene: ENSMUSG00000041605
AA Change: V7I

DomainStartEndE-ValueType
Pfam:DUF3338 1 132 6.8e-58 PFAM
low complexity region 174 194 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000153910
SMART Domains Protein: ENSMUSP00000120263
Gene: ENSMUSG00000041605

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194374
Predicted Effect probably benign
Transcript: ENSMUST00000195177
AA Change: V7I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141506
Gene: ENSMUSG00000041605
AA Change: V7I

DomainStartEndE-ValueType
Pfam:DUF3338 1 78 5.2e-31 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Pibf1 A G 14: 99,140,557 Y373C probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in 5730559C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:5730559C18Rik APN 1 136219775 missense probably damaging 1.00
IGL02466:5730559C18Rik APN 1 136216435 unclassified probably null
IGL03408:5730559C18Rik APN 1 136214405 missense probably benign
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0632:5730559C18Rik UTSW 1 136227618 missense probably benign 0.06
R1218:5730559C18Rik UTSW 1 136214402 missense probably damaging 1.00
R1611:5730559C18Rik UTSW 1 136216117 missense probably damaging 1.00
R3618:5730559C18Rik UTSW 1 136214372 missense probably benign 0.11
R4256:5730559C18Rik UTSW 1 136214350 missense probably benign 0.00
R4348:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4350:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4353:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R5343:5730559C18Rik UTSW 1 136225442 missense probably benign 0.01
R6296:5730559C18Rik UTSW 1 136221071 critical splice donor site probably null
R6597:5730559C18Rik UTSW 1 136226189 missense probably damaging 1.00
R6983:5730559C18Rik UTSW 1 136220156 missense possibly damaging 0.59
R7060:5730559C18Rik UTSW 1 136220197 missense possibly damaging 0.75
R7503:5730559C18Rik UTSW 1 136215937 missense possibly damaging 0.76
R7527:5730559C18Rik UTSW 1 136214384 missense possibly damaging 0.67
X0017:5730559C18Rik UTSW 1 136220182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCTCCAGATAGGACAGGAAC -3'
(R):5'- ACTTCCATTCCCGACGCTCAAG -3'

Sequencing Primer
(F):5'- CTTGAGGTGCCAGATCTTCCAG -3'
(R):5'- CGCTCAAGCATTGAGACTTCATAG -3'
Posted On2014-08-06