Incidental Mutation 'R0053:Pibf1'
ID64342
Institutional Source Beutler Lab
Gene Symbol Pibf1
Ensembl Gene ENSMUSG00000022064
Gene Nameprogesterone immunomodulatory binding factor 1
Synonyms1700017E21Rik, 4933438D16Rik, 4933439E17Rik, D14Ertd581e, 4930513H15Rik
MMRRC Submission 038347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0053 (G1)
Quality Score127
Status Validated
Chromosome14
Chromosomal Location99099424-99254493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99140557 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 373 (Y373C)
Ref Sequence ENSEMBL: ENSMUSP00000022650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650]
Predicted Effect probably damaging
Transcript: ENSMUST00000022650
AA Change: Y373C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064
AA Change: Y373C

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,327,590 D711E probably benign Het
5730559C18Rik C T 1: 136,227,550 V106I probably benign Het
Ada A T 2: 163,732,292 V148D probably damaging Het
Alpi T C 1: 87,098,790 D493G probably benign Het
Atp10b A G 11: 43,216,564 probably benign Het
AY761185 A T 8: 20,944,530 probably benign Het
BC067074 T C 13: 113,368,489 W2051R probably benign Het
Cadm1 C T 9: 47,799,414 T205I probably damaging Het
Capn3 A G 2: 120,491,837 I413V possibly damaging Het
Cblb C T 16: 52,142,801 T369I probably damaging Het
Ccdc54 T A 16: 50,590,234 N223I probably benign Het
Cdc25c A G 18: 34,735,435 V294A probably benign Het
Cep170 A T 1: 176,782,380 S122T possibly damaging Het
Chd1 A G 17: 15,747,189 N849D probably damaging Het
Dpp3 A G 19: 4,923,126 C147R probably damaging Het
Dst A G 1: 34,294,550 probably null Het
Fbxw9 T A 8: 85,064,454 L250Q probably damaging Het
Gpr75 A T 11: 30,892,571 Q492L possibly damaging Het
Gramd4 T A 15: 86,130,138 probably benign Het
Hivep2 T C 10: 14,132,121 C1488R probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Insr A G 8: 3,155,683 S1369P probably damaging Het
Insrr A C 3: 87,800,452 D67A probably damaging Het
Irf2 T A 8: 46,818,851 Y158N probably benign Het
Katnbl1 A G 2: 112,404,241 R23G probably benign Het
Lamb2 T A 9: 108,486,737 C987* probably null Het
Lzts2 T C 19: 45,026,307 probably benign Het
Mmp14 T A 14: 54,438,652 probably benign Het
Mycbpap A G 11: 94,511,736 Y258H probably damaging Het
Nav3 A G 10: 109,766,917 probably benign Het
Olfr1186 T A 2: 88,526,163 N193K probably damaging Het
Olfr1406 T C 1: 173,184,278 D52G probably benign Het
Parp10 T A 15: 76,242,246 L247F probably damaging Het
Pcsk6 C T 7: 65,983,703 probably benign Het
Pgap3 A T 11: 98,391,098 V129D probably damaging Het
Plcb1 A G 2: 135,294,915 E310G probably benign Het
Plin3 T C 17: 56,279,892 D385G probably damaging Het
Pole A T 5: 110,293,340 D220V probably damaging Het
Ptprk T A 10: 28,475,109 F533I probably damaging Het
Rufy1 A T 11: 50,401,465 M499K probably benign Het
Scn1a T G 2: 66,299,775 D1232A probably benign Het
Sec23ip T C 7: 128,745,167 L49P probably damaging Het
Sf3b1 G A 1: 55,000,373 Q698* probably null Het
Shprh A T 10: 11,194,372 probably null Het
Snd1 C A 6: 28,745,335 probably benign Het
Stab1 C T 14: 31,140,687 A2260T possibly damaging Het
Stpg2 A G 3: 139,212,321 Q60R probably benign Het
Strn T C 17: 78,656,934 H687R possibly damaging Het
Tgfb3 A T 12: 86,077,829 I35N probably damaging Het
Tnks2 T C 19: 36,875,365 S166P probably damaging Het
Tyw5 G A 1: 57,401,438 T55M probably damaging Het
Usp19 A G 9: 108,497,170 probably null Het
Zfp13 A T 17: 23,576,148 I483N probably damaging Het
Other mutations in Pibf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Pibf1 APN 14 99179449 nonsense probably null
IGL01649:Pibf1 APN 14 99187763 missense possibly damaging 0.88
IGL01817:Pibf1 APN 14 99186472 splice site probably benign
IGL02322:Pibf1 APN 14 99210983 missense probably damaging 1.00
IGL03180:Pibf1 APN 14 99133344 missense probably benign 0.14
IGL03269:Pibf1 APN 14 99187735 missense probably damaging 0.98
IGL03354:Pibf1 APN 14 99150738 missense probably benign 0.13
R0969:Pibf1 UTSW 14 99196386 missense probably benign 0.02
R0981:Pibf1 UTSW 14 99150743 critical splice donor site probably null
R1110:Pibf1 UTSW 14 99112973 missense probably damaging 0.99
R1205:Pibf1 UTSW 14 99101203 missense probably damaging 1.00
R1356:Pibf1 UTSW 14 99137196 missense possibly damaging 0.91
R1432:Pibf1 UTSW 14 99112989 missense probably benign 0.14
R1622:Pibf1 UTSW 14 99186481 missense probably benign 0.34
R1912:Pibf1 UTSW 14 99187809 critical splice donor site probably null
R2393:Pibf1 UTSW 14 99242932 missense probably benign 0.07
R3847:Pibf1 UTSW 14 99137121 missense possibly damaging 0.57
R4028:Pibf1 UTSW 14 99179341 missense probably damaging 0.99
R4673:Pibf1 UTSW 14 99133351 missense possibly damaging 0.93
R4857:Pibf1 UTSW 14 99186501 nonsense probably null
R4874:Pibf1 UTSW 14 99140556 missense probably damaging 1.00
R4992:Pibf1 UTSW 14 99150667 missense probably damaging 0.98
R5330:Pibf1 UTSW 14 99140646 missense probably damaging 1.00
R5543:Pibf1 UTSW 14 99112992 missense probably benign 0.38
R5582:Pibf1 UTSW 14 99137130 missense possibly damaging 0.64
R5922:Pibf1 UTSW 14 99137088 missense probably benign
R6088:Pibf1 UTSW 14 99179358 missense probably benign 0.01
R6169:Pibf1 UTSW 14 99113007 missense probably null 0.96
R6226:Pibf1 UTSW 14 99101119 missense probably damaging 1.00
R6232:Pibf1 UTSW 14 99186578 missense probably benign 0.16
R6339:Pibf1 UTSW 14 99107398 missense probably damaging 0.97
R6450:Pibf1 UTSW 14 99137210 missense probably damaging 1.00
R6828:Pibf1 UTSW 14 99186551 missense probably benign 0.31
R7185:Pibf1 UTSW 14 99107316 missense possibly damaging 0.80
R7201:Pibf1 UTSW 14 99196408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTATGAAAGACGAATGAGACGGCAC -3'
(R):5'- CTGAGGTAACAGGAAACAGACACATTAGG -3'

Sequencing Primer
(F):5'- cgctgtcaccatctgtaaatc -3'
(R):5'- GCCTTGTTGTAATTAGCCATCAAAG -3'
Posted On2013-08-06