Incidental Mutation 'R1981:Usp18'
ID222297
Institutional Source Beutler Lab
Gene Symbol Usp18
Ensembl Gene ENSMUSG00000030107
Gene Nameubiquitin specific peptidase 18
Synonyms1110058H21Rik, UBP43
MMRRC Submission 039993-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1981 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121245906-121270917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121252517 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 32 (K32E)
Ref Sequence ENSEMBL: ENSMUSP00000032198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032198]
Predicted Effect probably benign
Transcript: ENSMUST00000032198
AA Change: K32E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032198
Gene: ENSMUSG00000030107
AA Change: K32E

DomainStartEndE-ValueType
Pfam:UCH 51 363 3.1e-41 PFAM
Pfam:UCH_1 52 335 6.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203718
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mutants die prematurely with cellular necrosis in the ependyma, breakdown of blood-brain barrier, hydrocephaly with enlarged ventricles, and severe neurological abnormalities. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to Salmonella infection and LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A T X: 89,931,445 V382E probably damaging Het
Anks1 T C 17: 27,985,121 V181A probably damaging Het
Aqp4 T C 18: 15,393,551 D291G probably damaging Het
Atad1 G T 19: 32,695,810 D224E probably benign Het
Atp1a3 T G 7: 25,000,975 E33A probably benign Het
Baz2b A G 2: 59,923,680 F1100L possibly damaging Het
Car7 C T 8: 104,548,377 probably benign Het
Casp8 C A 1: 58,828,962 probably null Het
Cdh23 A T 10: 60,378,751 L1495H probably damaging Het
Ceacam9 T G 7: 16,725,307 L177R probably benign Het
Col16a1 C G 4: 130,065,443 P346A unknown Het
Cyp2c29 A G 19: 39,307,772 probably null Het
Cyp3a13 T C 5: 137,911,856 S139G probably damaging Het
Dapk2 A G 9: 66,268,898 H327R probably benign Het
Ddx19b T C 8: 111,009,343 T357A possibly damaging Het
Dnah2 A G 11: 69,474,325 Y1944H probably damaging Het
Dnaic2 T A 11: 114,732,929 V6E probably damaging Het
Eipr1 T C 12: 28,863,025 Y242H probably damaging Het
Fam149a T G 8: 45,381,741 D7A probably damaging Het
Fam217a T A 13: 34,916,754 D140V probably benign Het
Fat4 G A 3: 38,991,664 C3944Y probably damaging Het
Fezf2 G T 14: 12,344,405 P261T probably benign Het
Gcsam A T 16: 45,619,974 T127S probably damaging Het
Git2 C T 5: 114,749,559 probably benign Het
Gm1527 T C 3: 28,915,835 probably null Het
Gm7030 T A 17: 36,128,722 D122V probably damaging Het
Gtf3c1 A G 7: 125,644,272 L1720P possibly damaging Het
Hat1 A G 2: 71,389,977 T28A probably benign Het
Igf2r G A 17: 12,733,903 Q219* probably null Het
Impdh1 T A 6: 29,206,451 D129V possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Ltbp3 A G 19: 5,758,079 Q1250R probably benign Het
Mansc4 T A 6: 147,075,675 I148F probably benign Het
Mast2 T C 4: 116,314,840 Y569C probably damaging Het
Mcoln3 A T 3: 146,140,590 K552* probably null Het
Mctp2 T C 7: 72,164,698 Q601R probably benign Het
Mei1 A G 15: 82,103,312 N859S probably benign Het
Myo19 A T 11: 84,892,170 Q170L possibly damaging Het
Myo1h T C 5: 114,353,837 F676S probably damaging Het
Myo9a A G 9: 59,894,146 T1876A probably benign Het
Nav3 G T 10: 109,719,090 probably benign Het
Ndor1 T C 2: 25,255,224 Y43C probably damaging Het
Nlrp1a A G 11: 71,098,938 V1102A probably damaging Het
Nmnat3 T C 9: 98,410,299 I199T possibly damaging Het
Nsun7 T C 5: 66,261,214 S96P probably damaging Het
Ntng1 A G 3: 109,935,010 V149A possibly damaging Het
Oas3 T C 5: 120,761,835 probably benign Het
Olfr1055 A T 2: 86,347,142 I208N possibly damaging Het
Olfr1297 T A 2: 111,621,241 I278F probably benign Het
Olfr1350 A G 7: 6,570,558 D189G probably benign Het
Olfr1418 T G 19: 11,855,007 Q315H possibly damaging Het
Olfr147 T C 9: 38,403,735 L287P probably damaging Het
Olfr5 T C 7: 6,480,932 M75V probably benign Het
Pax2 G A 19: 44,818,465 D301N probably damaging Het
Pcsk4 T A 10: 80,325,779 E176V probably damaging Het
Pkhd1 G A 1: 20,117,060 P3675S probably benign Het
Plekho2 A T 9: 65,558,692 L138Q probably damaging Het
Prkcsh A G 9: 22,012,868 D458G probably damaging Het
Prr11 T A 11: 87,103,290 D100V probably damaging Het
Qars A G 9: 108,515,028 N136D probably damaging Het
Rbm15b A G 9: 106,881,623 probably benign Het
Rel C T 11: 23,742,761 G424D probably benign Het
Rsrc1 A G 3: 67,350,005 D250G probably benign Het
Samt3 A C X: 86,047,134 M211L probably benign Het
Scn2a C A 2: 65,690,170 N503K probably damaging Het
Sh2d6 G A 6: 72,517,544 probably benign Het
Smg8 T C 11: 87,085,331 T475A probably benign Het
Ssxb10 A G X: 8,331,019 D77G probably benign Het
Tbx20 T A 9: 24,770,913 K48N possibly damaging Het
Tead1 C A 7: 112,891,745 D231E probably benign Het
Ticam1 C T 17: 56,271,555 R180H probably damaging Het
Tjp1 A T 7: 65,312,855 F1111L probably damaging Het
Tlr11 T A 14: 50,361,988 I477K possibly damaging Het
Ttc13 A G 8: 124,714,187 probably null Het
Ttc17 T C 2: 94,326,704 N411S possibly damaging Het
Usp15 T A 10: 123,125,041 probably benign Het
Vmn1r12 A T 6: 57,159,661 M248L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp930 T A 8: 69,228,172 L172H probably damaging Het
Zfp976 G A 7: 42,613,622 H264Y probably damaging Het
Other mutations in Usp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Usp18 APN 6 121255382 nonsense probably null
IGL01403:Usp18 APN 6 121268668 missense possibly damaging 0.67
IGL01411:Usp18 APN 6 121261421 missense probably benign 0.01
IGL01810:Usp18 APN 6 121253771 missense probably damaging 1.00
IGL02568:Usp18 APN 6 121261091 missense probably benign 0.00
IGL02613:Usp18 APN 6 121261090 missense probably benign 0.11
R0961:Usp18 UTSW 6 121261493 missense probably benign 0.00
R1350:Usp18 UTSW 6 121262692 missense possibly damaging 0.64
R1855:Usp18 UTSW 6 121262117 missense probably benign 0.07
R1916:Usp18 UTSW 6 121268554 missense probably benign 0.14
R2015:Usp18 UTSW 6 121268550 missense probably damaging 1.00
R4062:Usp18 UTSW 6 121261367 missense probably benign
R5000:Usp18 UTSW 6 121252520 missense possibly damaging 0.84
R5894:Usp18 UTSW 6 121261497 missense probably benign 0.03
R6006:Usp18 UTSW 6 121262822 missense possibly damaging 0.58
R6932:Usp18 UTSW 6 121252514 missense probably benign 0.01
R7357:Usp18 UTSW 6 121253849 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGTGTAGACTCTGCCTGGAAG -3'
(R):5'- TCGGGGACAACAGATTTCAGC -3'

Sequencing Primer
(F):5'- AGTGAAGTTGTGGACTCCCGAC -3'
(R):5'- CGAGGCTGTAATGACCAT -3'
Posted On2014-08-25