Incidental Mutation 'R2016:Erap1'
ID223086
Institutional Source Beutler Lab
Gene Symbol Erap1
Ensembl Gene ENSMUSG00000021583
Gene Nameendoplasmic reticulum aminopeptidase 1
SynonymsERAAP, Arts1, PILSAP
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74639568-74693201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74664151 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 362 (W362R)
Ref Sequence ENSEMBL: ENSMUSP00000133166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169114] [ENSMUST00000221822] [ENSMUST00000222127]
Predicted Effect probably damaging
Transcript: ENSMUST00000169114
AA Change: W362R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583
AA Change: W362R

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221606
Predicted Effect probably benign
Transcript: ENSMUST00000221822
Predicted Effect probably benign
Transcript: ENSMUST00000222127
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a targeted mutation may exhibit extramedullary hematopoiesis of the spleen, thymus hyperplasia, or enlarged kidneys at older ages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Erap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Erap1 APN 13 74673659 missense probably benign 0.17
IGL00661:Erap1 APN 13 74674789 unclassified probably benign
IGL00903:Erap1 APN 13 74673707 missense probably benign
IGL01095:Erap1 APN 13 74668094 missense probably benign 0.04
IGL01536:Erap1 APN 13 74662423 nonsense probably null
IGL01646:Erap1 APN 13 74666172 missense probably damaging 1.00
IGL01674:Erap1 APN 13 74664231 unclassified probably benign
IGL01795:Erap1 APN 13 74666090 unclassified probably null
IGL01922:Erap1 APN 13 74662387 missense probably damaging 1.00
IGL01951:Erap1 APN 13 74675295 missense probably damaging 0.99
IGL02106:Erap1 APN 13 74646639 missense probably benign
IGL02369:Erap1 APN 13 74666526 missense probably benign 0.05
IGL02669:Erap1 APN 13 74675868 missense probably benign 0.13
IGL02866:Erap1 APN 13 74667999 missense probably damaging 0.96
IGL03093:Erap1 APN 13 74675280 missense probably benign 0.10
IGL03265:Erap1 APN 13 74664127 missense probably damaging 1.00
R0091:Erap1 UTSW 13 74668052 missense possibly damaging 0.88
R0456:Erap1 UTSW 13 74664220 missense probably benign 0.24
R0556:Erap1 UTSW 13 74660325 missense probably damaging 1.00
R0627:Erap1 UTSW 13 74675814 unclassified probably benign
R0825:Erap1 UTSW 13 74674614 unclassified probably benign
R1123:Erap1 UTSW 13 74673643 missense probably benign
R1530:Erap1 UTSW 13 74646543 missense probably benign 0.06
R1619:Erap1 UTSW 13 74671381 missense probably damaging 1.00
R1731:Erap1 UTSW 13 74666122 nonsense probably null
R1944:Erap1 UTSW 13 74646639 missense probably benign
R2022:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2023:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2045:Erap1 UTSW 13 74669450 missense probably benign 0.01
R2081:Erap1 UTSW 13 74675307 missense possibly damaging 0.67
R2187:Erap1 UTSW 13 74662405 missense probably damaging 0.98
R2198:Erap1 UTSW 13 74646687 missense probably damaging 0.97
R3938:Erap1 UTSW 13 74668028 missense probably damaging 1.00
R4052:Erap1 UTSW 13 74675340 missense probably benign 0.13
R4062:Erap1 UTSW 13 74663536 missense probably benign 0.02
R4128:Erap1 UTSW 13 74666196 missense probably damaging 1.00
R4247:Erap1 UTSW 13 74675295 missense probably damaging 0.99
R4562:Erap1 UTSW 13 74673659 missense probably benign 0.21
R4691:Erap1 UTSW 13 74673692 missense probably damaging 0.99
R4831:Erap1 UTSW 13 74690647 missense probably damaging 1.00
R4916:Erap1 UTSW 13 74646528 missense probably benign
R4983:Erap1 UTSW 13 74690710 missense probably benign 0.01
R5213:Erap1 UTSW 13 74671495 splice site probably null
R5229:Erap1 UTSW 13 74660375 missense possibly damaging 0.94
R5367:Erap1 UTSW 13 74646561 missense probably damaging 0.99
R5463:Erap1 UTSW 13 74646414 missense probably damaging 1.00
R5566:Erap1 UTSW 13 74662412 missense probably damaging 1.00
R5972:Erap1 UTSW 13 74662304 splice site probably null
R6112:Erap1 UTSW 13 74646279 missense probably benign 0.44
R6132:Erap1 UTSW 13 74660282 missense probably benign 0.00
R6180:Erap1 UTSW 13 74666226 missense possibly damaging 0.55
R6314:Erap1 UTSW 13 74674775 missense probably damaging 0.99
R6479:Erap1 UTSW 13 74663493 unclassified probably null
R6919:Erap1 UTSW 13 74671433 missense probably benign 0.20
R7199:Erap1 UTSW 13 74666139 missense probably benign 0.10
R7283:Erap1 UTSW 13 74673784 splice site probably null
R7543:Erap1 UTSW 13 74674634 missense probably damaging 1.00
X0067:Erap1 UTSW 13 74660372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTTTGCGACAAATGAAGCTAC -3'
(R):5'- CTGATGCTACAGCTGTGAGG -3'

Sequencing Primer
(F):5'- TGCGACAAATGAAGCTACTCATACTG -3'
(R):5'- CAGCTGTGAGGTGGGAGTG -3'
Posted On2014-08-25