Incidental Mutation 'R2129:Abhd14a'
ID227850
Institutional Source Beutler Lab
Gene Symbol Abhd14a
Ensembl Gene ENSMUSG00000042210
Gene Nameabhydrolase domain containing 14A
Synonyms1110013B16Rik, Dorz1
MMRRC Submission 040132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2129 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106440051-106447678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106440865 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 125 (L125Q)
Ref Sequence ENSEMBL: ENSMUSP00000126916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000048685] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000187001] [ENSMUST00000187983] [ENSMUST00000190798] [ENSMUST00000190803] [ENSMUST00000190900] [ENSMUST00000190972] [ENSMUST00000214275] [ENSMUST00000215395] [ENSMUST00000215506] [ENSMUST00000216400]
Predicted Effect probably null
Transcript: ENSMUST00000024031
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171925
AA Change: L125Q
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210
AA Change: L125Q

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187798
Predicted Effect probably null
Transcript: ENSMUST00000187983
SMART Domains Protein: ENSMUSP00000140901
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Abhydrolase_5 73 203 5.4e-12 PFAM
Pfam:Abhydrolase_6 74 197 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189097
Predicted Effect probably null
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190851
Predicted Effect probably null
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably null
Transcript: ENSMUST00000190972
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214275
Predicted Effect probably null
Transcript: ENSMUST00000215395
Predicted Effect probably benign
Transcript: ENSMUST00000215506
Predicted Effect probably null
Transcript: ENSMUST00000216400
Meta Mutation Damage Score 0.6444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,230,204 E249G possibly damaging Het
2610028H24Rik A G 10: 76,457,515 M136V possibly damaging Het
4930523C07Rik A T 1: 160,075,375 K72* probably null Het
Abhd17b T A 19: 21,681,049 probably null Het
Abo G A 2: 26,846,574 T61I probably benign Het
Adamts15 T C 9: 30,904,503 T686A probably benign Het
Adgrv1 A T 13: 81,557,080 F1537Y probably damaging Het
Anxa2 A T 9: 69,476,128 Y75F possibly damaging Het
Aqp3 T A 4: 41,098,061 I17F probably benign Het
Aspm T C 1: 139,457,635 V339A probably benign Het
BC055324 T C 1: 163,966,457 Y518C probably damaging Het
Bri3bp T A 5: 125,451,671 L48* probably null Het
Car7 T A 8: 104,548,973 C185S possibly damaging Het
Casp8ap2 T C 4: 32,640,142 Y399H probably benign Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chst10 A G 1: 38,865,695 Y203H probably benign Het
Clca1 T C 3: 145,016,765 D282G probably damaging Het
Coq3 T G 4: 21,900,342 S190A probably benign Het
Crocc G A 4: 141,017,096 R1830C probably damaging Het
Cygb A G 11: 116,649,842 L106P probably damaging Het
Dab2 G T 15: 6,336,383 E87* probably null Het
Dcst1 T A 3: 89,357,545 I299F probably damaging Het
Dennd4a T G 9: 64,905,974 probably null Het
Depdc7 A G 2: 104,728,173 S168P probably benign Het
Dicer1 G A 12: 104,722,031 T429I probably damaging Het
Dnah5 A G 15: 28,408,321 Q3484R probably benign Het
Dock2 T C 11: 34,727,415 M125V probably damaging Het
Dync2h1 A G 9: 7,175,289 S107P possibly damaging Het
Emb T C 13: 117,267,546 V278A probably damaging Het
Foxk1 C A 5: 142,435,188 S189* probably null Het
Galm T C 17: 80,183,218 I268T probably benign Het
Gm5581 A C 6: 131,168,284 noncoding transcript Het
Gpr6 G A 10: 41,071,172 S138L possibly damaging Het
Hesx1 C A 14: 27,000,845 H42Q possibly damaging Het
Hsp90b1 T C 10: 86,695,706 D421G probably damaging Het
Kctd19 T C 8: 105,385,172 T31A probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krtap19-3 T C 16: 88,877,975 probably benign Het
Lin28a T A 4: 134,018,154 I43F probably benign Het
Lrriq1 G A 10: 103,214,857 T678I probably benign Het
Macf1 A G 4: 123,368,815 probably benign Het
Madcam1 A G 10: 79,665,572 E157G possibly damaging Het
Mctp1 A G 13: 76,824,822 D648G probably damaging Het
Megf8 T C 7: 25,330,715 L425P probably damaging Het
Mospd4 A G 18: 46,465,664 noncoding transcript Het
Mybpc1 T G 10: 88,551,452 T466P probably damaging Het
Myo10 T C 15: 25,781,799 Y1127H probably benign Het
Myo18b A T 5: 112,831,078 L1223Q probably damaging Het
Myo9b T C 8: 71,333,699 Y670H probably damaging Het
Ndufaf4 G T 4: 24,898,608 D55Y probably damaging Het
Neurod2 G T 11: 98,327,588 A250E possibly damaging Het
Nipsnap1 C A 11: 4,888,932 N119K probably benign Het
Npffr2 A T 5: 89,568,065 I84F probably damaging Het
Olfr330 T C 11: 58,529,611 D125G probably damaging Het
Olfr479 T A 7: 108,055,904 N307K probably benign Het
Olfr748 A G 14: 50,710,636 Y102C probably damaging Het
Pald1 A G 10: 61,348,306 probably null Het
Palld T C 8: 61,877,361 S161G probably benign Het
Paqr9 T A 9: 95,561,069 F371I probably benign Het
Pear1 A T 3: 87,758,359 C120* probably null Het
Pla2g4e A T 2: 120,182,811 F343I probably damaging Het
Plxdc2 A T 2: 16,512,091 Y61F probably benign Het
Polh G A 17: 46,188,088 Q234* probably null Het
Prkce T A 17: 86,496,035 M454K possibly damaging Het
Proser1 C A 3: 53,477,945 T416K probably benign Het
Prr14l G T 5: 32,831,828 probably benign Het
Rabgap1l A T 1: 160,738,957 D90E probably benign Het
Rp1l1 T A 14: 64,028,966 V667D possibly damaging Het
Rpp40 A T 13: 35,898,621 C256* probably null Het
Rps6ka5 A G 12: 100,678,538 L51P probably damaging Het
Rtp2 C T 16: 23,927,707 C78Y probably damaging Het
Ryr3 A G 2: 112,678,370 probably benign Het
Slc10a6 A G 5: 103,609,056 Y281H probably benign Het
Slc6a21 T G 7: 45,282,773 probably null Het
Slc9a3r1 A T 11: 115,176,444 I174F probably damaging Het
Smo A G 6: 29,757,314 Y476C probably damaging Het
Tacr3 A T 3: 134,854,860 T187S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tasp1 T C 2: 140,048,244 K71E possibly damaging Het
Tg A G 15: 66,694,894 I1264V probably benign Het
Tmem41a T C 16: 21,946,161 probably null Het
Tmem63a A G 1: 180,965,540 N459D probably benign Het
Ube2k A G 5: 65,594,926 T151A probably damaging Het
Ubr1 T C 2: 120,942,553 E402G probably benign Het
Ulk4 T A 9: 121,152,182 I897F probably benign Het
Usp30 A G 5: 114,111,163 E176G probably damaging Het
Utp20 A G 10: 88,814,055 F431S probably damaging Het
Vmn1r206 T C 13: 22,620,612 S142G probably benign Het
Wdr17 C T 8: 54,632,381 V1236M probably damaging Het
Zbtb32 T C 7: 30,591,493 K126E possibly damaging Het
Zeb1 A T 18: 5,767,681 S731C possibly damaging Het
Other mutations in Abhd14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Abhd14a APN 9 106443929 missense possibly damaging 0.49
IGL03204:Abhd14a APN 9 106440635 missense probably damaging 0.99
R0050:Abhd14a UTSW 9 106440883 unclassified probably benign
R1937:Abhd14a UTSW 9 106440247 unclassified probably benign
R5521:Abhd14a UTSW 9 106443834 missense probably damaging 1.00
R5850:Abhd14a UTSW 9 106440349 missense probably damaging 1.00
R5971:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
R5975:Abhd14a UTSW 9 106443951 splice site probably null
R6138:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
R6644:Abhd14a UTSW 9 106444273 missense probably damaging 0.98
U15987:Abhd14a UTSW 9 106443866 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGGGCACGAATCCACGTAG -3'
(R):5'- CCAGTACTGGGTGTTATCCAC -3'

Sequencing Primer
(F):5'- ACGAATCCACGTAGCTGGTG -3'
(R):5'- CTAGTCATCCAGATATGTGCAGCTG -3'
Posted On2014-09-17