Incidental Mutation 'R2104:Mms22l'
ID230763
Institutional Source Beutler Lab
Gene Symbol Mms22l
Ensembl Gene ENSMUSG00000045751
Gene NameMMS22-like, DNA repair protein
SynonymsF730047E07Rik
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location24496451-24602950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24591084 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1018 (N1018K)
Ref Sequence ENSEMBL: ENSMUSP00000103857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222]
Predicted Effect probably benign
Transcript: ENSMUST00000050446
AA Change: N978K

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: N978K

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 395 1.1e-199 PFAM
Pfam:MMS22L_N 392 690 4.6e-155 PFAM
low complexity region 698 711 N/A INTRINSIC
low complexity region 761 770 N/A INTRINSIC
Pfam:MMS22L_C 809 1186 2.3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108222
AA Change: N1018K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: N1018K

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 730 N/A PFAM
low complexity region 738 751 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:MMS22L_C 849 1225 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123984
Predicted Effect probably benign
Transcript: ENSMUST00000131282
SMART Domains Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 459 1.3e-239 PFAM
low complexity region 467 480 N/A INTRINSIC
low complexity region 530 539 N/A INTRINSIC
Pfam:MMS22L_C 578 733 1.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154349
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Mms22l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Mms22l APN 4 24502805 missense probably damaging 1.00
IGL02158:Mms22l APN 4 24505349 missense probably damaging 0.98
IGL02533:Mms22l APN 4 24581099 splice site probably benign
IGL02612:Mms22l APN 4 24508482 missense probably benign 0.03
IGL02685:Mms22l APN 4 24591133 missense probably benign
IGL03000:Mms22l APN 4 24581161 missense probably damaging 0.99
IGL03006:Mms22l APN 4 24521253 missense probably damaging 1.00
PIT4280001:Mms22l UTSW 4 24581149 missense probably benign 0.08
R0157:Mms22l UTSW 4 24588224 missense probably damaging 1.00
R0279:Mms22l UTSW 4 24497867 missense probably damaging 1.00
R0669:Mms22l UTSW 4 24517223 missense probably benign 0.00
R1056:Mms22l UTSW 4 24586344 critical splice donor site probably null
R1232:Mms22l UTSW 4 24536274 missense probably benign 0.24
R1389:Mms22l UTSW 4 24591076 missense probably damaging 1.00
R1543:Mms22l UTSW 4 24591084 missense probably benign 0.41
R1604:Mms22l UTSW 4 24502804 missense probably damaging 1.00
R1872:Mms22l UTSW 4 24598807 missense probably damaging 0.99
R1929:Mms22l UTSW 4 24535936 unclassified probably benign
R2024:Mms22l UTSW 4 24588365 missense probably damaging 1.00
R2081:Mms22l UTSW 4 24536150 missense probably damaging 1.00
R2147:Mms22l UTSW 4 24580063 nonsense probably null
R2379:Mms22l UTSW 4 24496929 missense possibly damaging 0.87
R2496:Mms22l UTSW 4 24521269 missense probably benign 0.31
R3508:Mms22l UTSW 4 24586224 missense probably benign 0.01
R3625:Mms22l UTSW 4 24505357 missense probably damaging 1.00
R3789:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R4422:Mms22l UTSW 4 24503008 missense probably damaging 1.00
R4623:Mms22l UTSW 4 24502792 nonsense probably null
R4799:Mms22l UTSW 4 24580052 critical splice acceptor site probably null
R4825:Mms22l UTSW 4 24536226 missense probably damaging 1.00
R5236:Mms22l UTSW 4 24588347 missense probably benign 0.02
R5276:Mms22l UTSW 4 24578774 missense probably damaging 1.00
R5364:Mms22l UTSW 4 24496882 unclassified probably benign
R5394:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R6905:Mms22l UTSW 4 24503107 missense probably benign 0.00
R7206:Mms22l UTSW 4 24591146 missense probably benign 0.00
R7290:Mms22l UTSW 4 24517139 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAAGTCAGCTCTGTATGCC -3'
(R):5'- ATCATATGTACCTTATGGCATGGAC -3'

Sequencing Primer
(F):5'- CAGAAGTCCTACTTGACGGTG -3'
(R):5'- TACCTTATGGCATGGACAGTGTGC -3'
Posted On2014-09-18