Incidental Mutation 'R2180:Ptpn13'
ID237113
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 040182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R2180 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103569558 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1855 (H1855Q)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957]
Predicted Effect probably damaging
Transcript: ENSMUST00000048957
AA Change: H1855Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: H1855Q

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T A 4: 41,507,170 M209L probably benign Het
Adamts5 T C 16: 85,887,924 D377G probably damaging Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Anxa9 T C 3: 95,306,424 probably null Het
Aox4 A T 1: 58,213,067 T34S probably benign Het
Asic1 G T 15: 99,671,965 V56F probably benign Het
Atpaf1 T C 4: 115,788,360 M1T probably null Het
Axin1 A G 17: 26,143,335 T218A probably benign Het
BC049762 C A 11: 51,254,610 W50L probably damaging Het
Bdp1 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC 13: 100,061,405 probably benign Het
Birc6 T C 17: 74,612,151 I1988T probably benign Het
Btbd7 A T 12: 102,785,897 D869E probably damaging Het
Caln1 T C 5: 130,839,408 *220Q probably null Het
Ccdc150 G A 1: 54,272,547 probably null Het
Ccnt1 A T 15: 98,543,600 S596T possibly damaging Het
Cd44 C T 2: 102,828,610 G640E possibly damaging Het
Cep192 A G 18: 67,824,742 E582G possibly damaging Het
Clcnkb G T 4: 141,409,508 probably null Het
Dhx29 T C 13: 112,962,872 probably null Het
Dnah8 T C 17: 30,840,647 F4407S probably benign Het
Enah A T 1: 181,918,459 M419K probably damaging Het
Fam129a A T 1: 151,718,078 H838L probably benign Het
Fancd2 A T 6: 113,574,637 T1055S probably benign Het
Gigyf2 G A 1: 87,416,920 G525D probably damaging Het
Gm5800 T A 14: 51,715,994 K55* probably null Het
Gpr149 A G 3: 62,604,068 L170P probably damaging Het
Grik4 A T 9: 42,542,005 Y695N probably benign Het
Gsg1 A T 6: 135,240,145 V228D probably damaging Het
Helb G A 10: 120,105,448 T445M probably benign Het
Helz2 A T 2: 181,233,732 D1656E probably damaging Het
Hyou1 A T 9: 44,388,019 K669M probably benign Het
Itga2 T C 13: 114,849,381 N953D possibly damaging Het
Ldhd T C 8: 111,629,386 I122V probably benign Het
Lrrtm1 A G 6: 77,244,346 D262G probably damaging Het
Mapkapk5 T C 5: 121,535,864 probably null Het
Numa1 T C 7: 101,999,990 I976T probably benign Het
Olfr1307 A G 2: 111,945,003 V151A probably benign Het
Olfr417 A G 1: 174,369,401 I161M probably damaging Het
Olfr446 C T 6: 42,927,525 T98I probably benign Het
Olfr677 T C 7: 105,056,885 I213T probably benign Het
Patj G A 4: 98,523,502 probably null Het
Pfas T C 11: 68,992,187 D757G possibly damaging Het
Pom121l2 A G 13: 21,981,975 N139D probably benign Het
Ppp2r3a A T 9: 101,127,015 Y994* probably null Het
Ppp6c T C 2: 39,197,513 D227G probably benign Het
Ptprh T A 7: 4,601,868 Q59L probably benign Het
Rap1gap2 T C 11: 74,393,146 K669E probably benign Het
Rbl2 T C 8: 91,090,055 S348P possibly damaging Het
Rptor T A 11: 119,725,144 N161K probably damaging Het
Satb1 C T 17: 51,803,496 A192T probably damaging Het
Scn5a A G 9: 119,516,051 V1083A probably benign Het
Sec14l2 C T 11: 4,108,964 A194T probably damaging Het
Sema4b A G 7: 80,212,835 N53S probably benign Het
Sin3b T A 8: 72,753,295 Y876* probably null Het
Smchd1 C A 17: 71,463,799 M129I probably benign Het
Tmc1 T C 19: 20,824,084 Y484C probably damaging Het
Utp20 A G 10: 88,820,939 S135P probably damaging Het
Zfp266 A T 9: 20,499,679 C401S probably damaging Het
Zfp738 G A 13: 67,671,194 T226I probably damaging Het
Zfp871 G A 17: 32,775,301 T300M probably damaging Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7253:Ptpn13 UTSW 5 103565284 missense possibly damaging 0.68
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
R7391:Ptpn13 UTSW 5 103540981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATCACCATAAATCTCTTACTGG -3'
(R):5'- ATGTGGACTGCCTTGACCTC -3'

Sequencing Primer
(F):5'- ATGTTTCCTGTTCCAAAAACCAAAC -3'
(R):5'- TGCCTTGACCTCCAGACAG -3'
Posted On2014-10-02