Incidental Mutation 'R2272:Carnmt1'
ID242609
Institutional Source Beutler Lab
Gene Symbol Carnmt1
Ensembl Gene ENSMUSG00000024726
Gene Namecarnosine N-methyltransferase 1
Synonyms2410127L17Rik
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18670780-18704788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18703370 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 336 (L336P)
Ref Sequence ENSEMBL: ENSMUSP00000025632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025632]
Predicted Effect probably damaging
Transcript: ENSMUST00000025632
AA Change: L336P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025632
Gene: ENSMUSG00000024726
AA Change: L336P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
N2227 135 400 2.56e-169 SMART
Meta Mutation Damage Score 0.528 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts carnosine to anserine, a dipeptide found abundantly in skeletal muscle. The encoded protein can methylate other dipeptides as well. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Carnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Carnmt1 APN 19 18703382 missense possibly damaging 0.92
IGL01347:Carnmt1 APN 19 18691454 missense probably benign 0.21
R0088:Carnmt1 UTSW 19 18677853 missense probably benign 0.02
R1929:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2270:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2271:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2519:Carnmt1 UTSW 19 18693711 missense probably benign 0.41
R4597:Carnmt1 UTSW 19 18671087 missense probably damaging 1.00
R5030:Carnmt1 UTSW 19 18691586 missense possibly damaging 0.82
R5114:Carnmt1 UTSW 19 18677734 missense probably damaging 1.00
R5933:Carnmt1 UTSW 19 18704105 missense probably benign 0.00
R7262:Carnmt1 UTSW 19 18677864 missense probably benign 0.33
R7394:Carnmt1 UTSW 19 18670837 start gained probably benign
X0024:Carnmt1 UTSW 19 18677704 nonsense probably null
X0065:Carnmt1 UTSW 19 18690309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGATGTTTTCTTAGGTGAAACGG -3'
(R):5'- TTACCCAGGCCATTGTCAGC -3'

Sequencing Primer
(F):5'- AAACGGATTGGTTTTTGTTTCAGAG -3'
(R):5'- AGGCCATTGTCAGCTACCATTATTG -3'
Posted On2014-10-16