Incidental Mutation 'R2272:Myo9a'
ID242574
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59815301 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 549 (F549I)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably damaging
Transcript: ENSMUST00000128341
AA Change: F549I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: F549I

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135298
AA Change: F549I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: F549I

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136740
AA Change: F549I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: F549I

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6194:Myo9a UTSW 9 59869750 missense probably benign 0.00
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACATGCATGCGTTTGTGCG -3'
(R):5'- ATGCACTGTCTGAATCAAAATGCAG -3'

Sequencing Primer
(F):5'- ATGCCAGAGGTATCAGATTCCCTG -3'
(R):5'- GTCTGAATCAAAATGCAGGCTAG -3'
Posted On2014-10-16