Incidental Mutation 'R2272:Mrc2'
ID242585
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105348431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.6228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Klhl1 T C 14: 96,517,908 D137G probably benign Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTGAGCTGCCAGAGAAG -3'
(R):5'- CTGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On2014-10-16