Incidental Mutation 'R2272:Klhl1'
ID242591
Institutional Source Beutler Lab
Gene Symbol Klhl1
Ensembl Gene ENSMUSG00000022076
Gene Namekelch-like 1
Synonyms
MMRRC Submission 040272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2272 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location96102736-96519102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96517908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 137 (D137G)
Ref Sequence ENSEMBL: ENSMUSP00000022666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022666]
Predicted Effect probably benign
Transcript: ENSMUST00000022666
AA Change: D137G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: D137G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
BTB 215 312 1.13e-28 SMART
BACK 317 418 5.03e-34 SMART
Kelch 463 509 8.86e-10 SMART
Kelch 510 556 1.04e-15 SMART
Kelch 557 603 6.76e-15 SMART
Kelch 604 650 2.23e-15 SMART
Kelch 651 703 3.09e-9 SMART
Kelch 704 750 3.43e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Ago1 C A 4: 126,453,650 M435I probably benign Het
Apol7b G A 15: 77,423,710 A195V probably damaging Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Arntl2 T C 6: 146,822,114 F314S probably damaging Het
Atg2b C T 12: 105,638,008 V1545I probably benign Het
Atp4a C A 7: 30,715,500 S238* probably null Het
Birc6 T C 17: 74,602,971 V1453A probably benign Het
Brinp3 A G 1: 146,901,404 R530G possibly damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Cdh22 A T 2: 165,143,847 probably null Het
Cdk5rap2 A C 4: 70,266,678 S1178R probably benign Het
Cdkl3 T C 11: 52,032,495 V45A probably benign Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Dnah10 A G 5: 124,731,466 N195S probably benign Het
Dnah9 T C 11: 66,112,362 D872G probably benign Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Hydin A T 8: 110,309,132 I152L probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnq3 T A 15: 66,028,680 D242V probably damaging Het
Lama5 T C 2: 180,178,603 D3282G possibly damaging Het
Lhx8 A G 3: 154,316,762 L254S probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matn4 A T 2: 164,397,242 C232S possibly damaging Het
Mios C T 6: 8,226,865 R614C possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc6 T A 7: 141,637,510 T2417S possibly damaging Het
Mycbp2 T C 14: 103,144,338 H3612R probably null Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Myo7b C T 18: 31,977,043 S1122N probably benign Het
Myo9a T A 9: 59,815,301 F549I probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Neil1 A G 9: 57,146,785 S84P probably damaging Het
Nfix A G 8: 84,727,175 I256T probably damaging Het
Nlrp4f A T 13: 65,194,408 D474E probably benign Het
Olfr203 T G 16: 59,303,444 M98R possibly damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
Pcnx T C 12: 81,995,314 V2240A probably benign Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Prkdc A G 16: 15,654,817 probably null Het
Prpf8 T A 11: 75,495,363 V946E probably damaging Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Prss54 C T 8: 95,571,107 W45* probably null Het
Psg29 A T 7: 17,210,696 N377I probably benign Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Serpinb9c C T 13: 33,154,541 G125E probably damaging Het
Skint4 A G 4: 112,119,868 T152A probably benign Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Slc47a2 A T 11: 61,328,526 probably null Het
Ttc39d A G 17: 80,217,246 K445E probably damaging Het
Ttn T A 2: 76,764,520 E20394V probably damaging Het
Ugt2b36 A G 5: 87,066,255 V510A possibly damaging Het
Usf1 T C 1: 171,418,060 L291P possibly damaging Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn1r172 A C 7: 23,660,191 D167A probably damaging Het
Wnt10b T A 15: 98,774,347 Q163L probably damaging Het
Other mutations in Klhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Klhl1 APN 14 96201204 splice site probably benign
IGL02055:Klhl1 APN 14 96280103 missense possibly damaging 0.96
IGL02110:Klhl1 APN 14 96136603 missense probably benign 0.27
IGL02216:Klhl1 APN 14 96123222 missense probably benign 0.08
IGL02307:Klhl1 APN 14 96201373 missense possibly damaging 0.68
IGL02538:Klhl1 APN 14 96240213 missense probably benign 0.03
IGL02559:Klhl1 APN 14 96151960 missense possibly damaging 0.95
IGL02682:Klhl1 APN 14 96201342 missense possibly damaging 0.83
IGL03228:Klhl1 APN 14 96240327 missense probably damaging 1.00
LCD18:Klhl1 UTSW 14 96317730 intron probably benign
P0041:Klhl1 UTSW 14 96280211 missense probably damaging 1.00
R0270:Klhl1 UTSW 14 96518344 start gained probably benign
R0419:Klhl1 UTSW 14 96381789 missense probably benign 0.30
R0938:Klhl1 UTSW 14 96152040 nonsense probably null
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1590:Klhl1 UTSW 14 96368636 missense probably damaging 1.00
R1597:Klhl1 UTSW 14 96201211 critical splice donor site probably null
R1893:Klhl1 UTSW 14 96240206 critical splice donor site probably null
R1928:Klhl1 UTSW 14 96346789 missense probably benign 0.02
R3612:Klhl1 UTSW 14 96381770 critical splice donor site probably null
R3852:Klhl1 UTSW 14 96280205 missense probably benign 0.12
R3872:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3874:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3923:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3925:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3926:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R4151:Klhl1 UTSW 14 96518316 start codon destroyed probably null 0.73
R4502:Klhl1 UTSW 14 96517846 missense probably benign
R4536:Klhl1 UTSW 14 96136583 critical splice donor site probably null
R4729:Klhl1 UTSW 14 96280148 missense probably damaging 1.00
R4756:Klhl1 UTSW 14 96151966 missense probably benign 0.39
R5001:Klhl1 UTSW 14 96136610 missense probably damaging 0.96
R5022:Klhl1 UTSW 14 96136706 missense probably benign 0.31
R5616:Klhl1 UTSW 14 96518293 missense probably benign 0.44
R5634:Klhl1 UTSW 14 96240271 missense probably damaging 0.96
R5700:Klhl1 UTSW 14 96518040 missense probably benign
R5701:Klhl1 UTSW 14 96201380 missense probably benign
R5934:Klhl1 UTSW 14 96123215 critical splice donor site probably null
R5950:Klhl1 UTSW 14 96240354 missense probably damaging 0.99
R6454:Klhl1 UTSW 14 96280091 missense possibly damaging 0.66
R6496:Klhl1 UTSW 14 96240216 missense probably benign 0.03
R6606:Klhl1 UTSW 14 96123222 missense possibly damaging 0.52
R6644:Klhl1 UTSW 14 96517918 missense probably benign
R6745:Klhl1 UTSW 14 96280002 critical splice donor site probably null
R6919:Klhl1 UTSW 14 96136594 missense probably benign 0.00
R7029:Klhl1 UTSW 14 96518196 missense probably benign 0.01
R7195:Klhl1 UTSW 14 96280077 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACAGGCTGGCATCTATCTCAG -3'
(R):5'- TTTGAGCACTGGGGTCCTAG -3'

Sequencing Primer
(F):5'- AGGCTGGCATCTATCTCAGATTTTC -3'
(R):5'- GTCGGCTGCTCAAAAACCAGG -3'
Posted On2014-10-16