Incidental Mutation 'R2410:Or4c118'
ID 249941
Institutional Source Beutler Lab
Gene Symbol Or4c118
Ensembl Gene ENSMUSG00000075100
Gene Name olfactory receptor family 4 subfamily C member 118
Synonyms MOR233-10, Olfr1223, GA_x6K02T2Q125-50623664-50622729
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2410 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88974430-88981680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88974899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 156 (I156N)
Ref Sequence ENSEMBL: ENSMUSP00000097381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099793] [ENSMUST00000217342]
AlphaFold A0A1L1SU13
Predicted Effect possibly damaging
Transcript: ENSMUST00000099793
AA Change: I156N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: I156N

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111554
AA Change: I156N

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107179
Gene: ENSMUSG00000075100
AA Change: I156N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.1e-48 PFAM
Pfam:7tm_1 39 286 1.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217342
AA Change: I156N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Adgrf5 C A 17: 43,766,157 (GRCm39) N1326K probably benign Het
Ciita A G 16: 10,328,568 (GRCm39) E284G probably damaging Het
Ctbp2 T C 7: 132,616,083 (GRCm39) Y284C probably benign Het
Dnah11 T C 12: 117,991,262 (GRCm39) D2368G probably damaging Het
Enpp3 C T 10: 24,650,716 (GRCm39) V807I probably benign Het
Erich3 A G 3: 154,439,240 (GRCm39) D491G probably damaging Het
Ero1a C T 14: 45,542,723 (GRCm39) V101I possibly damaging Het
Fbxl7 A G 15: 26,895,111 (GRCm39) Y9H possibly damaging Het
Fzd2 A G 11: 102,496,453 (GRCm39) Y299C possibly damaging Het
Lamc1 G A 1: 153,123,141 (GRCm39) T683M possibly damaging Het
Lrrc39 C T 3: 116,374,899 (GRCm39) P327S probably benign Het
Marf1 A T 16: 13,933,691 (GRCm39) F1566I probably benign Het
Me2 A T 18: 73,924,183 (GRCm39) M343K probably damaging Het
Mlxip T A 5: 123,581,132 (GRCm39) W260R probably damaging Het
Mrps17 T C 5: 129,795,047 (GRCm39) V64A probably damaging Het
Phldb3 C T 7: 24,323,719 (GRCm39) S450L probably benign Het
Pi4k2a A G 19: 42,093,316 (GRCm39) E219G possibly damaging Het
Polr1a T C 6: 71,951,866 (GRCm39) S1478P probably benign Het
Rab14 T C 2: 35,076,762 (GRCm39) probably null Het
Rnf43 T C 11: 87,623,085 (GRCm39) Y729H possibly damaging Het
Sgms1 G A 19: 32,137,072 (GRCm39) R165* probably null Het
Sorbs1 T A 19: 40,361,959 (GRCm39) I142F probably damaging Het
Tmem255b A G 8: 13,491,278 (GRCm39) I66V probably benign Het
Vmn2r9 T C 5: 108,996,123 (GRCm39) D175G probably damaging Het
Zfp954 A T 7: 7,120,808 (GRCm39) I74N probably benign Het
Other mutations in Or4c118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Or4c118 APN 2 88,974,575 (GRCm39) missense possibly damaging 0.55
IGL01560:Or4c118 APN 2 88,974,947 (GRCm39) missense probably damaging 1.00
IGL01817:Or4c118 APN 2 88,974,702 (GRCm39) missense probably benign 0.01
IGL02669:Or4c118 APN 2 88,974,564 (GRCm39) nonsense probably null
IGL03270:Or4c118 APN 2 88,975,089 (GRCm39) missense probably damaging 0.98
R0062:Or4c118 UTSW 2 88,974,966 (GRCm39) missense possibly damaging 0.95
R0062:Or4c118 UTSW 2 88,974,966 (GRCm39) missense possibly damaging 0.95
R0304:Or4c118 UTSW 2 88,975,108 (GRCm39) nonsense probably null
R1651:Or4c118 UTSW 2 88,975,346 (GRCm39) missense probably damaging 1.00
R1971:Or4c118 UTSW 2 88,975,078 (GRCm39) nonsense probably null
R2006:Or4c118 UTSW 2 88,975,241 (GRCm39) missense probably benign 0.21
R2101:Or4c118 UTSW 2 88,975,301 (GRCm39) missense probably benign 0.03
R3683:Or4c118 UTSW 2 88,975,364 (GRCm39) start codon destroyed probably null 1.00
R3685:Or4c118 UTSW 2 88,975,364 (GRCm39) start codon destroyed probably null 1.00
R3939:Or4c118 UTSW 2 88,974,474 (GRCm39) nonsense probably null
R6162:Or4c118 UTSW 2 88,975,114 (GRCm39) missense probably benign 0.00
R8431:Or4c118 UTSW 2 88,974,723 (GRCm39) missense probably benign 0.06
R8842:Or4c118 UTSW 2 88,975,074 (GRCm39) missense probably benign
R9631:Or4c118 UTSW 2 88,975,522 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTCAGAACTGTGAGATCTC -3'
(R):5'- ACGAAGACCATCTCCTTTGAATG -3'

Sequencing Primer
(F):5'- TCTCAGAGAGAATAAGATGACACC -3'
(R):5'- ACCATCTCCTTTGAATGTTGTATGG -3'
Posted On 2014-11-12