Incidental Mutation 'R2414:Tesk2'
ID250095
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
MMRRC Submission 040378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R2414 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116801757 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 276 (W276R)
Ref Sequence ENSEMBL: ENSMUSP00000102067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045542
AA Change: V277A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: V277A

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106456
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106459
AA Change: W276R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985
AA Change: W276R

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154945
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C A 9: 121,908,974 S138R probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arfgef2 A G 2: 166,845,504 E216G probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
AU040320 A T 4: 126,868,691 probably null Het
BC002059 T C 17: 16,973,670 noncoding transcript Het
Cep112 A G 11: 108,752,582 N799S possibly damaging Het
Cilp A G 9: 65,274,645 probably benign Het
Cpn2 T C 16: 30,260,574 E103G probably benign Het
Cpt1b G A 15: 89,420,080 probably benign Het
Epor T A 9: 21,959,489 D365V probably damaging Het
Hip1r T C 5: 124,001,243 Y900H probably damaging Het
Hist2h2be T A 3: 96,221,434 I90N possibly damaging Het
Hoxc9 A T 15: 102,984,108 N251I probably damaging Het
Hpd C T 5: 123,177,524 probably null Het
Lrrc34 T A 3: 30,634,562 I197L probably benign Het
Msi2 A G 11: 88,716,547 V78A probably damaging Het
Myh4 A G 11: 67,250,768 I818V probably benign Het
Nol4 T C 18: 22,823,572 probably null Het
Plekha5 A G 6: 140,550,856 N362S probably damaging Het
Polr1b A G 2: 129,103,134 probably benign Het
Rc3h2 A T 2: 37,399,819 probably null Het
Sgsm3 A G 15: 81,006,745 N136D probably benign Het
Slco1a5 A G 6: 142,236,250 C583R probably damaging Het
Surf1 A G 2: 26,916,283 W13R probably damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Togaram2 T G 17: 71,716,309 probably benign Het
Ttll11 A G 2: 35,979,534 S31P unknown Het
Ttll8 A G 15: 88,936,133 probably benign Het
Tub A G 7: 109,027,033 K259E probably damaging Het
Ube2o T C 11: 116,548,857 I162M probably benign Het
Vamp8 C T 6: 72,388,343 M1I probably null Het
Zfp503 C A 14: 21,985,964 G295* probably null Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 intron probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6464:Tesk2 UTSW 4 116802849 missense probably damaging 1.00
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACGATGGAACTGTTTTACCC -3'
(R):5'- CTCTGGAGAGCCTGTACAGATC -3'

Sequencing Primer
(F):5'- CGATGGAACTGTTTTACCCTTGGG -3'
(R):5'- AGGAATATGGTTGGTGTTACACATC -3'
Posted On2014-11-12