Incidental Mutation 'R2655:Chaf1b'
ID252694
Institutional Source Beutler Lab
Gene Symbol Chaf1b
Ensembl Gene ENSMUSG00000022945
Gene Namechromatin assembly factor 1, subunit B (p60)
Synonyms2600017H24Rik, CAF1P60, CAF1A, MPHOSPH7, CAF1, CAF-I 60 kDa subunit, CAF-IP60, CAF-1 subunit B
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93883901-93906115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93891511 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 165 (S165P)
Ref Sequence ENSEMBL: ENSMUSP00000113684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023666] [ENSMUST00000117099] [ENSMUST00000120586] [ENSMUST00000143006]
Predicted Effect probably damaging
Transcript: ENSMUST00000023666
AA Change: S165P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023666
Gene: ENSMUSG00000022945
AA Change: S165P

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 564 2e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117099
AA Change: S165P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113684
Gene: ENSMUSG00000022945
AA Change: S165P

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
WD40 118 157 3.78e-9 SMART
WD40 160 199 5.86e-6 SMART
Blast:WD40 219 258 5e-10 BLAST
WD40 274 338 2.84e2 SMART
WD40 344 381 5.13e0 SMART
Pfam:CAF-1_p60_C 388 561 6.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120586
SMART Domains Protein: ENSMUSP00000113420
Gene: ENSMUSG00000022945

DomainStartEndE-ValueType
WD40 3 45 4.95e0 SMART
WD40 55 94 4.44e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124313
Predicted Effect probably benign
Transcript: ENSMUST00000143006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232065
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF-I) is required for the assembly of histone octamers onto newly-replicated DNA. CAF-I is composed of three protein subunits, p50, p60, and p150. The protein encoded by this gene corresponds to the p60 subunit and is required for chromatin assembly after replication. The encoded protein is differentially phosphorylated in a cell cycle-dependent manner. In addition, it is normally found in the nucleus except during mitosis, when it is released into the cytoplasm. This protein is a member of the WD-repeat HIR1 family and may also be involved in DNA repair. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Chaf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Chaf1b APN 16 93900191 unclassified probably benign
R0090:Chaf1b UTSW 16 93887124 missense possibly damaging 0.52
R0309:Chaf1b UTSW 16 93884511 missense probably damaging 0.96
R0690:Chaf1b UTSW 16 93900017 splice site probably benign
R1494:Chaf1b UTSW 16 93888110 missense probably damaging 1.00
R1572:Chaf1b UTSW 16 93901230 missense possibly damaging 0.77
R1595:Chaf1b UTSW 16 93905099 critical splice donor site probably null
R1654:Chaf1b UTSW 16 93894903 missense probably damaging 0.97
R2057:Chaf1b UTSW 16 93894907 missense probably damaging 1.00
R2280:Chaf1b UTSW 16 93891571 missense probably damaging 1.00
R2406:Chaf1b UTSW 16 93900155 missense probably damaging 0.99
R4522:Chaf1b UTSW 16 93901295 missense probably benign 0.05
R4605:Chaf1b UTSW 16 93888089 missense possibly damaging 0.90
R4686:Chaf1b UTSW 16 93884584 missense probably benign 0.00
R4784:Chaf1b UTSW 16 93884542 missense probably damaging 1.00
R4862:Chaf1b UTSW 16 93887134 missense probably damaging 0.99
R5603:Chaf1b UTSW 16 93892795 missense probably damaging 1.00
R5683:Chaf1b UTSW 16 93887142 missense possibly damaging 0.90
R6763:Chaf1b UTSW 16 93891505 missense probably damaging 1.00
R6940:Chaf1b UTSW 16 93905965 missense probably benign 0.00
R7401:Chaf1b UTSW 16 93884380 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TACATCCTGGCTGCCTTGAG -3'
(R):5'- TGTCTTGTCAGAATAGCAGATCC -3'

Sequencing Primer
(F):5'- CTGCCTTGAGTGCTGCAG -3'
(R):5'- CCAAAGCTGGACTATCGA -3'
Posted On2014-12-04