Incidental Mutation 'R2880:Vmn2r65'
ID260277
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission 040468-MU
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84963886 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 42 (C42S)
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably damaging
Transcript: ENSMUST00000044583
AA Change: C42S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372
AA Change: C42S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
PIT4651001:Vmn2r65 UTSW 7 84946253 missense probably benign 0.12
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1508:Vmn2r65 UTSW 7 84940678 missense probably benign 0.00
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4768:Vmn2r65 UTSW 7 84947394 missense probably damaging 1.00
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5673:Vmn2r65 UTSW 7 84947407 missense probably benign 0.23
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTGAACAAAATGCCTAATCC -3'
(R):5'- TACTGCACTTGACTCAGGCTC -3'

Sequencing Primer
(F):5'- CAAAATGCCTAATCCAGAAATAGGG -3'
(R):5'- CTTGACTCAGGCTCAAGGCATAG -3'
Posted On2015-01-23