Incidental Mutation 'R0335:Adamts12'
ID26224
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission 038544-MU
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R0335 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11311058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1134 (D1134Y)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061318
AA Change: D1134Y

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: D1134Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Top2a T C 11: 99,022,955 N20S probably benign Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTGGCTCCACCATAGCATCCCAAG -3'
(R):5'- CAAGTGGTAGTTCTGCATCCGTCTC -3'

Sequencing Primer
(F):5'- TGGGATGGCAGAATAATTCAACC -3'
(R):5'- CATGGGAGCATCATGTTCAGG -3'
Posted On2013-04-16