Incidental Mutation 'R3030:Smarca2'
ID 264713
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms Snf2l2, brm, 2610209L14Rik
MMRRC Submission 040546-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3030 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 26582578-26755721 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 26729429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 100 (N100T)
Ref Sequence ENSEMBL: ENSMUSP00000146994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000112637] [ENSMUST00000175791] [ENSMUST00000175842] [ENSMUST00000175953] [ENSMUST00000176030] [ENSMUST00000176731] [ENSMUST00000176475] [ENSMUST00000176698] [ENSMUST00000176769] [ENSMUST00000177252] [ENSMUST00000207054] [ENSMUST00000207118] [ENSMUST00000208091] [ENSMUST00000208712] [ENSMUST00000208186] [ENSMUST00000208751] [ENSMUST00000209085] [ENSMUST00000207812] [ENSMUST00000207832] [ENSMUST00000208027] [ENSMUST00000208589] [ENSMUST00000208705] [ENSMUST00000208806] [ENSMUST00000208226] [ENSMUST00000208915] [ENSMUST00000208541]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025862
AA Change: N1407T

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: N1407T

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099537
AA Change: N1407T

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: N1407T

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112637
AA Change: N60T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108256
Gene: ENSMUSG00000024921
AA Change: N60T

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175791
AA Change: N60T

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135412
Gene: ENSMUSG00000024921
AA Change: N60T

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175842
AA Change: N100T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135800
Gene: ENSMUSG00000024921
AA Change: N100T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 212 1.74e-39 SMART
low complexity region 213 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175935
Predicted Effect probably benign
Transcript: ENSMUST00000175953
AA Change: N60T

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135042
Gene: ENSMUSG00000024921
AA Change: N60T

DomainStartEndE-ValueType
SCOP:d1jb0a_ 16 80 5e-3 SMART
PDB:2DAT|A 42 83 3e-23 PDB
Blast:BROMO 44 83 3e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176030
AA Change: N1407T

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: N1407T

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176731
AA Change: N214T
SMART Domains Protein: ENSMUSP00000135460
Gene: ENSMUSG00000024921
AA Change: N214T

DomainStartEndE-ValueType
PDB:2DAT|A 10 33 8e-9 PDB
Blast:BROMO 12 35 6e-7 BLAST
low complexity region 83 111 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176475
AA Change: N100T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135248
Gene: ENSMUSG00000024921
AA Change: N100T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 194 3.13e-41 SMART
low complexity region 195 217 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176698
AA Change: N60T

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134914
Gene: ENSMUSG00000024921
AA Change: N60T

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176700
Predicted Effect probably benign
Transcript: ENSMUST00000176769
AA Change: N1349T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: N1349T

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177252
AA Change: N60T

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134995
Gene: ENSMUSG00000024921
AA Change: N60T

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207054
AA Change: N102T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207118
AA Change: N100T

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177116
SMART Domains Protein: ENSMUSP00000135116
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
PDB:2DAT|A 1 33 4e-17 PDB
Blast:BROMO 1 37 1e-18 BLAST
SCOP:d1e6ia_ 1 43 3e-5 SMART
low complexity region 62 76 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208091
AA Change: N84T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000208712
AA Change: N60T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208186
AA Change: N100T

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208751
AA Change: N60T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209085
AA Change: N100T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000207535
AA Change: N31T
Predicted Effect possibly damaging
Transcript: ENSMUST00000207812
AA Change: N100T

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207832
AA Change: N100T

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208027
AA Change: N100T

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208589
AA Change: N60T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect unknown
Transcript: ENSMUST00000208674
AA Change: N188T
Predicted Effect probably benign
Transcript: ENSMUST00000208705
AA Change: N60T

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207944
Predicted Effect probably benign
Transcript: ENSMUST00000208806
Predicted Effect probably benign
Transcript: ENSMUST00000208226
Predicted Effect probably benign
Transcript: ENSMUST00000208915
Predicted Effect probably benign
Transcript: ENSMUST00000208541
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,477,682 (GRCm39) H1202Y possibly damaging Het
Acad8 G T 9: 26,890,355 (GRCm39) H287N probably benign Het
Aimp2 T C 5: 143,843,509 (GRCm39) Y27C probably damaging Het
Cd59a A T 2: 103,941,160 (GRCm39) D46V probably benign Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cyp4f17 T C 17: 32,725,950 (GRCm39) S28P possibly damaging Het
Dytn T A 1: 63,672,678 (GRCm39) E575V probably benign Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
Fbln2 G A 6: 91,210,697 (GRCm39) E214K probably damaging Het
H2-M11 C T 17: 36,859,042 (GRCm39) T194I possibly damaging Het
Helb A T 10: 119,925,487 (GRCm39) C963* probably null Het
Hspb1 C T 5: 135,918,267 (GRCm39) Q205* probably null Het
Itpkc G A 7: 26,911,733 (GRCm39) probably null Het
Kndc1 G T 7: 139,481,123 (GRCm39) A70S probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Nlrp2 G A 7: 5,330,747 (GRCm39) R550C probably damaging Het
Plin3 T C 17: 56,591,184 (GRCm39) K199E possibly damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Ppp4r4 A G 12: 103,573,215 (GRCm39) M705V probably benign Het
Slc22a3 T C 17: 12,676,521 (GRCm39) I291V probably benign Het
Tmem260 T C 14: 48,722,458 (GRCm39) F331S probably damaging Het
Trank1 A G 9: 111,220,598 (GRCm39) Q2445R possibly damaging Het
Umod A G 7: 119,076,062 (GRCm39) S235P probably benign Het
Vdr T C 15: 97,755,444 (GRCm39) T360A probably benign Het
Vmn1r76 A G 7: 11,664,402 (GRCm39) S236P probably damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26,751,694 (GRCm39) missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26,675,865 (GRCm39) missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26,693,537 (GRCm39) missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26,650,140 (GRCm39) missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26,693,582 (GRCm39) missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26,617,986 (GRCm39) missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26,654,024 (GRCm39) splice site probably benign
IGL03028:Smarca2 APN 19 26,655,712 (GRCm39) splice site probably benign
IGL03187:Smarca2 APN 19 26,650,224 (GRCm39) missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26,601,375 (GRCm39) missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26,597,303 (GRCm39) missense probably benign 0.01
Genghis UTSW 19 26,597,284 (GRCm39) missense possibly damaging 0.53
kraft UTSW 19 26,655,763 (GRCm39) missense probably damaging 0.99
Kublai UTSW 19 26,618,013 (GRCm39) missense probably damaging 1.00
Samarkand UTSW 19 26,631,864 (GRCm39) nonsense probably null
tashkent UTSW 19 26,698,273 (GRCm39) missense probably benign 0.06
Xanadu UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.52
FR4737:Smarca2 UTSW 19 26,608,399 (GRCm39) unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26,626,493 (GRCm39) missense probably benign 0.35
R0184:Smarca2 UTSW 19 26,669,649 (GRCm39) nonsense probably null
R0306:Smarca2 UTSW 19 26,618,013 (GRCm39) missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26,668,762 (GRCm39) missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26,659,275 (GRCm39) missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26,668,791 (GRCm39) missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26,683,600 (GRCm39) missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26,675,803 (GRCm39) missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26,748,333 (GRCm39) splice site probably benign
R1256:Smarca2 UTSW 19 26,659,373 (GRCm39) missense probably benign 0.06
R1299:Smarca2 UTSW 19 26,749,011 (GRCm39) critical splice donor site probably null
R1306:Smarca2 UTSW 19 26,748,388 (GRCm39) missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26,608,228 (GRCm39) missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26,654,140 (GRCm39) missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26,688,084 (GRCm39) missense probably null 0.72
R1496:Smarca2 UTSW 19 26,608,501 (GRCm39) missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26,729,305 (GRCm39) missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26,624,434 (GRCm39) missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26,624,434 (GRCm39) missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26,617,780 (GRCm39) splice site probably benign
R1861:Smarca2 UTSW 19 26,601,284 (GRCm39) missense probably benign 0.03
R1962:Smarca2 UTSW 19 26,650,124 (GRCm39) nonsense probably null
R1964:Smarca2 UTSW 19 26,650,124 (GRCm39) nonsense probably null
R1998:Smarca2 UTSW 19 26,608,493 (GRCm39) missense probably benign 0.33
R2014:Smarca2 UTSW 19 26,661,305 (GRCm39) missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26,748,438 (GRCm39) missense probably benign 0.01
R2392:Smarca2 UTSW 19 26,618,050 (GRCm39) critical splice donor site probably null
R2439:Smarca2 UTSW 19 26,668,854 (GRCm39) critical splice donor site probably null
R3195:Smarca2 UTSW 19 26,661,222 (GRCm39) missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26,668,749 (GRCm39) missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26,646,290 (GRCm39) unclassified probably benign
R3845:Smarca2 UTSW 19 26,698,273 (GRCm39) missense probably benign 0.06
R4013:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4014:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4016:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4271:Smarca2 UTSW 19 26,698,349 (GRCm39) critical splice donor site probably null
R4471:Smarca2 UTSW 19 26,597,277 (GRCm39) missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26,753,625 (GRCm39) missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26,608,073 (GRCm39) missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26,631,883 (GRCm39) missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26,698,255 (GRCm39) nonsense probably null
R5015:Smarca2 UTSW 19 26,668,788 (GRCm39) missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26,668,772 (GRCm39) missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26,617,829 (GRCm39) missense probably benign 0.18
R5503:Smarca2 UTSW 19 26,659,446 (GRCm39) missense possibly damaging 0.93
R5503:Smarca2 UTSW 19 26,601,336 (GRCm39) missense probably damaging 0.96
R5715:Smarca2 UTSW 19 26,626,522 (GRCm39) missense probably benign 0.16
R5790:Smarca2 UTSW 19 26,654,124 (GRCm39) missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26,753,469 (GRCm39) intron probably benign
R6209:Smarca2 UTSW 19 26,748,404 (GRCm39) nonsense probably null
R6236:Smarca2 UTSW 19 26,673,613 (GRCm39) missense probably benign 0.33
R6291:Smarca2 UTSW 19 26,608,292 (GRCm39) missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26,608,292 (GRCm39) missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26,655,763 (GRCm39) missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26,608,331 (GRCm39) missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26,656,573 (GRCm39) missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26,597,284 (GRCm39) missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26,631,777 (GRCm39) missense probably benign 0.30
R6804:Smarca2 UTSW 19 26,729,286 (GRCm39) missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26,668,749 (GRCm39) missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26,646,555 (GRCm39) missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26,624,531 (GRCm39) missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26,631,864 (GRCm39) nonsense probably null
R7259:Smarca2 UTSW 19 26,631,864 (GRCm39) nonsense probably null
R7479:Smarca2 UTSW 19 26,617,887 (GRCm39) missense probably benign 0.00
R7512:Smarca2 UTSW 19 26,661,209 (GRCm39) missense possibly damaging 0.51
R8158:Smarca2 UTSW 19 26,659,448 (GRCm39) missense probably benign 0.16
R8182:Smarca2 UTSW 19 26,608,120 (GRCm39) missense probably benign 0.39
R8207:Smarca2 UTSW 19 26,654,080 (GRCm39) missense possibly damaging 0.71
R8467:Smarca2 UTSW 19 26,597,121 (GRCm39) start codon destroyed probably null 0.02
R8527:Smarca2 UTSW 19 26,654,187 (GRCm39) missense probably damaging 0.98
R8784:Smarca2 UTSW 19 26,753,558 (GRCm39) missense probably benign 0.17
R8898:Smarca2 UTSW 19 26,608,358 (GRCm39) unclassified probably benign
R9076:Smarca2 UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.52
R9123:Smarca2 UTSW 19 26,693,583 (GRCm39) missense possibly damaging 0.84
R9125:Smarca2 UTSW 19 26,693,583 (GRCm39) missense possibly damaging 0.84
R9317:Smarca2 UTSW 19 26,737,279 (GRCm39) missense possibly damaging 0.75
R9501:Smarca2 UTSW 19 26,617,977 (GRCm39) missense probably benign 0.04
R9514:Smarca2 UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.71
R9641:Smarca2 UTSW 19 26,656,498 (GRCm39) missense possibly damaging 0.93
RF001:Smarca2 UTSW 19 26,608,421 (GRCm39) unclassified probably benign
RF001:Smarca2 UTSW 19 26,608,386 (GRCm39) unclassified probably benign
RF004:Smarca2 UTSW 19 26,608,420 (GRCm39) unclassified probably benign
RF019:Smarca2 UTSW 19 26,608,401 (GRCm39) unclassified probably benign
RF021:Smarca2 UTSW 19 26,608,397 (GRCm39) unclassified probably benign
RF024:Smarca2 UTSW 19 26,608,420 (GRCm39) unclassified probably benign
RF034:Smarca2 UTSW 19 26,608,411 (GRCm39) unclassified probably benign
RF040:Smarca2 UTSW 19 26,608,422 (GRCm39) unclassified probably benign
RF041:Smarca2 UTSW 19 26,608,421 (GRCm39) unclassified probably benign
RF047:Smarca2 UTSW 19 26,608,405 (GRCm39) unclassified probably benign
RF051:Smarca2 UTSW 19 26,608,388 (GRCm39) unclassified probably benign
X0061:Smarca2 UTSW 19 26,698,240 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATCGAAGACGGCAATTTG -3'
(R):5'- ATCTTAGACAACACACCGGG -3'

Sequencing Primer
(F):5'- TCGAAGACGGCAATTTGGAAGAAATG -3'
(R):5'- TAACAATCACAATCACGGCCGTTTC -3'
Posted On 2015-02-05