Incidental Mutation 'R3684:Ggta1'
ID269458
Institutional Source Beutler Lab
Gene Symbol Ggta1
Ensembl Gene ENSMUSG00000035778
Gene Nameglycoprotein galactosyltransferase alpha 1, 3
SynonymsGgta, glycoprotein alpha galactosyl transferase 1, GALT, Gal, Ggta-1, alpha3GalT, alpha Gal
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3684 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35400179-35463231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35407988 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 162 (T162S)
Ref Sequence ENSEMBL: ENSMUSP00000099858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044255] [ENSMUST00000079424] [ENSMUST00000102794] [ENSMUST00000113001] [ENSMUST00000113002] [ENSMUST00000131745] [ENSMUST00000164889]
Predicted Effect probably benign
Transcript: ENSMUST00000044255
AA Change: T162S

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049408
Gene: ENSMUSG00000035778
AA Change: T162S

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 81 404 1.2e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079424
AA Change: T128S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078393
Gene: ENSMUSG00000035778
AA Change: T128S

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 370 5.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102794
AA Change: T162S

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099858
Gene: ENSMUSG00000035778
AA Change: T162S

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 74 404 4.3e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113001
AA Change: T140S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108625
Gene: ENSMUSG00000035778
AA Change: T140S

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 45 382 3.6e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113002
AA Change: T150S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108626
Gene: ENSMUSG00000035778
AA Change: T150S

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131745
AA Change: T128S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115112
Gene: ENSMUSG00000035778
AA Change: T128S

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 140 1.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164889
AA Change: T150S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132408
Gene: ENSMUSG00000035778
AA Change: T150S

DomainStartEndE-ValueType
transmembrane domain 42 60 N/A INTRINSIC
Pfam:Glyco_transf_6 62 392 3.6e-182 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the galactosyltransferase family of intracellular, membrane-bound enzymes that are involved in the biosynthesis of glycoproteins and glycolipids. The encoded protein catalyzes the transfer of galactose from UDP-galactose to N-acetyllactosamine in an alpha(1,3) linkage to form galactose alpha(1,3)-galactose. Mice lacking the encoded protein develop cortical cataracts. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene display defects in humoral immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,775,699 Y54N probably damaging Het
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cep83 A G 10: 94,786,825 T588A probably benign Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Ppcdc C T 9: 57,421,125 probably null Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Zfp810 T C 9: 22,278,235 D459G probably benign Het
Other mutations in Ggta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ggta1 APN 2 35402450 nonsense probably null
IGL01903:Ggta1 APN 2 35402557 missense possibly damaging 0.74
IGL02796:Ggta1 APN 2 35413317 splice site probably benign
IGL02799:Ggta1 UTSW 2 35422199 missense probably damaging 0.98
R0383:Ggta1 UTSW 2 35402404 missense probably damaging 1.00
R1430:Ggta1 UTSW 2 35408017 missense possibly damaging 0.81
R1667:Ggta1 UTSW 2 35414283 missense possibly damaging 0.83
R1672:Ggta1 UTSW 2 35402133 nonsense probably null
R2246:Ggta1 UTSW 2 35402109 makesense probably null
R3149:Ggta1 UTSW 2 35402623 missense probably damaging 1.00
R3683:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R3685:Ggta1 UTSW 2 35407988 missense probably benign 0.39
R4812:Ggta1 UTSW 2 35402723 missense probably benign 0.01
R4856:Ggta1 UTSW 2 35402791 missense possibly damaging 0.59
R5079:Ggta1 UTSW 2 35422237 missense possibly damaging 0.94
R5756:Ggta1 UTSW 2 35402383 missense probably damaging 1.00
R6279:Ggta1 UTSW 2 35407994 missense probably damaging 1.00
R6651:Ggta1 UTSW 2 35402294 missense probably benign 0.00
R6967:Ggta1 UTSW 2 35402722 missense possibly damaging 0.91
R7152:Ggta1 UTSW 2 35402699 missense probably benign 0.00
R7529:Ggta1 UTSW 2 35414244 missense not run
R7534:Ggta1 UTSW 2 35402428 missense not run
R7557:Ggta1 UTSW 2 35402536 missense not run
X0010:Ggta1 UTSW 2 35402719 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAGCCATTATAAGAAAGAAGGG -3'
(R):5'- CCTATGCATTTGTGCCTGGC -3'

Sequencing Primer
(F):5'- GGGAAGTCTACTGTCAAATTCCAGC -3'
(R):5'- CTTTCATGCAGGCAAGATTCAGTGAC -3'
Posted On2015-02-19