Incidental Mutation 'R3684:Myh11'
ID 269486
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Name myosin, heavy polypeptide 11, smooth muscle
Synonyms smMHC, SM1, SM2
MMRRC Submission 040682-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3684 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 14012392-14109227 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14021098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1725 (N1725S)
Ref Sequence ENSEMBL: ENSMUSP00000155052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000090287
AA Change: N1725S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: N1725S

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230397
AA Change: N1725S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000231567
AA Change: N1732S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C T 14: 68,819,447 (GRCm39) V17I probably benign Het
Ahdc1 T C 4: 132,793,013 (GRCm39) L1418P possibly damaging Het
Atr T C 9: 95,802,453 (GRCm39) S1782P probably damaging Het
Btbd9 T A 17: 30,553,281 (GRCm39) N394Y probably damaging Het
Calb2 A G 8: 110,883,620 (GRCm39) Y35H probably benign Het
Cdon A G 9: 35,400,328 (GRCm39) E1014G possibly damaging Het
Cep83 A G 10: 94,622,687 (GRCm39) T588A probably benign Het
Cfap126 T C 1: 170,941,600 (GRCm39) S32P possibly damaging Het
Clcn7 T C 17: 25,369,567 (GRCm39) L301P possibly damaging Het
Corin T C 5: 72,488,198 (GRCm39) D610G probably damaging Het
Dok3 A G 13: 55,672,306 (GRCm39) S154P probably damaging Het
Ggta1 T A 2: 35,298,000 (GRCm39) T162S probably benign Het
Gldn G A 9: 54,245,624 (GRCm39) E392K possibly damaging Het
Gls A T 1: 52,205,452 (GRCm39) D447E probably damaging Het
Itih5 A T 2: 10,243,435 (GRCm39) N391Y possibly damaging Het
Jchain G A 5: 88,670,398 (GRCm39) P74S probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrrn1 T C 6: 107,544,910 (GRCm39) V236A probably benign Het
Mcm3ap T C 10: 76,325,260 (GRCm39) S954P possibly damaging Het
Ppcdc C T 9: 57,328,408 (GRCm39) probably null Het
Rhobtb3 A G 13: 76,087,600 (GRCm39) I129T probably damaging Het
Sfxn2 A G 19: 46,579,592 (GRCm39) R252G probably benign Het
Sh2d2a C A 3: 87,759,027 (GRCm39) probably null Het
Sh3gl1 T C 17: 56,325,953 (GRCm39) K159E possibly damaging Het
Slc7a9 A G 7: 35,152,926 (GRCm39) T115A probably benign Het
Spmap1 A T 11: 97,666,525 (GRCm39) Y54N probably damaging Het
Synj2 A T 17: 6,078,718 (GRCm39) D1020V probably damaging Het
Tenm2 C A 11: 35,942,644 (GRCm39) V1342L probably benign Het
Tmem127 T A 2: 127,090,652 (GRCm39) I56N possibly damaging Het
Traj7 A G 14: 54,448,938 (GRCm39) probably benign Het
Unc5d A G 8: 29,184,620 (GRCm39) F627L probably damaging Het
Unc79 T A 12: 103,041,062 (GRCm39) N698K probably benign Het
Usp17la A T 7: 104,510,937 (GRCm39) N514I possibly damaging Het
Uvrag A T 7: 98,637,427 (GRCm39) C341S probably damaging Het
Zfp810 T C 9: 22,189,531 (GRCm39) D459G probably benign Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14,095,586 (GRCm39) missense probably benign 0.00
IGL01398:Myh11 APN 16 14,019,964 (GRCm39) missense probably damaging 0.99
IGL01646:Myh11 APN 16 14,039,639 (GRCm39) missense probably damaging 1.00
IGL02470:Myh11 APN 16 14,035,910 (GRCm39) missense probably damaging 1.00
IGL02680:Myh11 APN 16 14,027,384 (GRCm39) missense probably benign 0.02
IGL02687:Myh11 APN 16 14,030,482 (GRCm39) nonsense probably null
IGL02987:Myh11 APN 16 14,050,396 (GRCm39) missense probably damaging 1.00
IGL03008:Myh11 APN 16 14,022,617 (GRCm39) missense probably benign 0.00
G5030:Myh11 UTSW 16 14,068,443 (GRCm39) missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14,018,930 (GRCm39) missense
R0008:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0085:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0086:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0087:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0096:Myh11 UTSW 16 14,022,231 (GRCm39) missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14,022,231 (GRCm39) missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14,029,124 (GRCm39) missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14,036,744 (GRCm39) missense probably benign 0.32
R0546:Myh11 UTSW 16 14,023,492 (GRCm39) missense probably damaging 1.00
R0658:Myh11 UTSW 16 14,041,883 (GRCm39) missense probably damaging 1.00
R0715:Myh11 UTSW 16 14,044,480 (GRCm39) missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14,021,042 (GRCm39) missense probably damaging 1.00
R1014:Myh11 UTSW 16 14,054,274 (GRCm39) missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14,019,991 (GRCm39) missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14,023,795 (GRCm39) nonsense probably null
R1560:Myh11 UTSW 16 14,044,484 (GRCm39) nonsense probably null
R1714:Myh11 UTSW 16 14,054,232 (GRCm39) critical splice donor site probably null
R1742:Myh11 UTSW 16 14,037,908 (GRCm39) missense probably damaging 1.00
R1750:Myh11 UTSW 16 14,033,654 (GRCm39) missense probably damaging 0.98
R1750:Myh11 UTSW 16 14,018,622 (GRCm39) missense probably damaging 1.00
R1753:Myh11 UTSW 16 14,095,734 (GRCm39) missense probably benign
R1760:Myh11 UTSW 16 14,051,559 (GRCm39) splice site probably benign
R1829:Myh11 UTSW 16 14,041,744 (GRCm39) missense probably damaging 1.00
R1876:Myh11 UTSW 16 14,086,967 (GRCm39) splice site probably benign
R2027:Myh11 UTSW 16 14,050,532 (GRCm39) missense probably damaging 1.00
R2122:Myh11 UTSW 16 14,035,868 (GRCm39) missense probably damaging 1.00
R2247:Myh11 UTSW 16 14,095,423 (GRCm39) missense probably damaging 1.00
R2495:Myh11 UTSW 16 14,023,421 (GRCm39) missense probably damaging 1.00
R2863:Myh11 UTSW 16 14,057,290 (GRCm39) missense probably benign 0.02
R3693:Myh11 UTSW 16 14,035,813 (GRCm39) missense probably benign 0.01
R4080:Myh11 UTSW 16 14,041,923 (GRCm39) missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14,036,747 (GRCm39) missense probably damaging 0.97
R4664:Myh11 UTSW 16 14,044,448 (GRCm39) missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14,087,105 (GRCm39) missense probably damaging 0.99
R4694:Myh11 UTSW 16 14,018,566 (GRCm39) missense probably damaging 1.00
R4805:Myh11 UTSW 16 14,052,329 (GRCm39) missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14,018,947 (GRCm39) splice site probably null
R4905:Myh11 UTSW 16 14,068,387 (GRCm39) missense probably benign 0.13
R4939:Myh11 UTSW 16 14,057,371 (GRCm39) missense probably benign
R4964:Myh11 UTSW 16 14,023,818 (GRCm39) missense probably damaging 1.00
R4966:Myh11 UTSW 16 14,023,818 (GRCm39) missense probably damaging 1.00
R5029:Myh11 UTSW 16 14,023,489 (GRCm39) missense probably damaging 1.00
R5045:Myh11 UTSW 16 14,057,391 (GRCm39) nonsense probably null
R5097:Myh11 UTSW 16 14,023,770 (GRCm39) splice site probably null
R5288:Myh11 UTSW 16 14,025,872 (GRCm39) missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14,025,872 (GRCm39) missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14,062,719 (GRCm39) missense probably damaging 0.96
R5856:Myh11 UTSW 16 14,023,840 (GRCm39) missense probably benign 0.00
R5869:Myh11 UTSW 16 14,048,664 (GRCm39) missense probably damaging 1.00
R6019:Myh11 UTSW 16 14,023,938 (GRCm39) missense probably damaging 1.00
R6024:Myh11 UTSW 16 14,095,567 (GRCm39) missense probably damaging 0.99
R6139:Myh11 UTSW 16 14,033,738 (GRCm39) missense probably damaging 1.00
R6209:Myh11 UTSW 16 14,026,155 (GRCm39) nonsense probably null
R6373:Myh11 UTSW 16 14,022,994 (GRCm39) missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14,044,480 (GRCm39) missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14,023,417 (GRCm39) missense probably damaging 1.00
R6709:Myh11 UTSW 16 14,041,358 (GRCm39) critical splice donor site probably null
R7069:Myh11 UTSW 16 14,036,803 (GRCm39) missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14,033,690 (GRCm39) missense
R7644:Myh11 UTSW 16 14,039,688 (GRCm39) missense
R7838:Myh11 UTSW 16 14,027,481 (GRCm39) missense
R7905:Myh11 UTSW 16 14,025,545 (GRCm39) nonsense probably null
R8261:Myh11 UTSW 16 14,041,867 (GRCm39) missense
R8272:Myh11 UTSW 16 14,036,718 (GRCm39) missense
R8317:Myh11 UTSW 16 14,025,941 (GRCm39) missense
R8359:Myh11 UTSW 16 14,026,095 (GRCm39) critical splice donor site probably null
R8486:Myh11 UTSW 16 14,022,532 (GRCm39) missense possibly damaging 0.77
R8527:Myh11 UTSW 16 14,048,570 (GRCm39) missense probably damaging 1.00
R8861:Myh11 UTSW 16 14,064,646 (GRCm39) missense
R8886:Myh11 UTSW 16 14,052,278 (GRCm39) missense
R8946:Myh11 UTSW 16 14,048,580 (GRCm39) missense probably benign 0.08
R9151:Myh11 UTSW 16 14,050,439 (GRCm39) missense
R9253:Myh11 UTSW 16 14,074,359 (GRCm39) missense
R9257:Myh11 UTSW 16 14,087,120 (GRCm39) missense
R9273:Myh11 UTSW 16 14,054,283 (GRCm39) missense
R9320:Myh11 UTSW 16 14,029,152 (GRCm39) missense
R9364:Myh11 UTSW 16 14,018,580 (GRCm39) missense
R9365:Myh11 UTSW 16 14,052,297 (GRCm39) missense
R9496:Myh11 UTSW 16 14,048,616 (GRCm39) nonsense probably null
R9499:Myh11 UTSW 16 14,064,673 (GRCm39) missense
R9551:Myh11 UTSW 16 14,064,673 (GRCm39) missense
R9554:Myh11 UTSW 16 14,018,580 (GRCm39) missense
R9631:Myh11 UTSW 16 14,025,441 (GRCm39) missense
R9661:Myh11 UTSW 16 14,041,857 (GRCm39) missense
R9679:Myh11 UTSW 16 14,095,436 (GRCm39) missense
R9780:Myh11 UTSW 16 14,064,613 (GRCm39) missense
R9790:Myh11 UTSW 16 14,025,992 (GRCm39) missense
R9791:Myh11 UTSW 16 14,025,992 (GRCm39) missense
X0018:Myh11 UTSW 16 14,095,497 (GRCm39) missense probably damaging 1.00
X0025:Myh11 UTSW 16 14,027,553 (GRCm39) missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14,052,266 (GRCm39) missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14,087,126 (GRCm39) frame shift probably null
Z1176:Myh11 UTSW 16 14,095,639 (GRCm39) missense
Z1176:Myh11 UTSW 16 14,057,260 (GRCm39) missense probably null
Z1177:Myh11 UTSW 16 14,027,459 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGAGTAGGTGTTCCCTCCC -3'
(R):5'- GCCAGAGCCTCAGAATCTAGTC -3'

Sequencing Primer
(F):5'- AGTAGGTGTTCCCTCCCTCTCC -3'
(R):5'- TTACCAGAGCCGATCAGTTG -3'
Posted On 2015-02-19