Incidental Mutation 'R3684:Clcn7'
ID 269488
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 040682-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3684 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25352365-25381078 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25369567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 301 (L301P)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
AlphaFold O70496
Predicted Effect possibly damaging
Transcript: ENSMUST00000040729
AA Change: L321P

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: L321P

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159773
SMART Domains Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 76 202 5.3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160961
AA Change: L301P

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: L301P

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162722
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C T 14: 68,819,447 (GRCm39) V17I probably benign Het
Ahdc1 T C 4: 132,793,013 (GRCm39) L1418P possibly damaging Het
Atr T C 9: 95,802,453 (GRCm39) S1782P probably damaging Het
Btbd9 T A 17: 30,553,281 (GRCm39) N394Y probably damaging Het
Calb2 A G 8: 110,883,620 (GRCm39) Y35H probably benign Het
Cdon A G 9: 35,400,328 (GRCm39) E1014G possibly damaging Het
Cep83 A G 10: 94,622,687 (GRCm39) T588A probably benign Het
Cfap126 T C 1: 170,941,600 (GRCm39) S32P possibly damaging Het
Corin T C 5: 72,488,198 (GRCm39) D610G probably damaging Het
Dok3 A G 13: 55,672,306 (GRCm39) S154P probably damaging Het
Ggta1 T A 2: 35,298,000 (GRCm39) T162S probably benign Het
Gldn G A 9: 54,245,624 (GRCm39) E392K possibly damaging Het
Gls A T 1: 52,205,452 (GRCm39) D447E probably damaging Het
Itih5 A T 2: 10,243,435 (GRCm39) N391Y possibly damaging Het
Jchain G A 5: 88,670,398 (GRCm39) P74S probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrrn1 T C 6: 107,544,910 (GRCm39) V236A probably benign Het
Mcm3ap T C 10: 76,325,260 (GRCm39) S954P possibly damaging Het
Myh11 T C 16: 14,021,098 (GRCm39) N1725S probably benign Het
Ppcdc C T 9: 57,328,408 (GRCm39) probably null Het
Rhobtb3 A G 13: 76,087,600 (GRCm39) I129T probably damaging Het
Sfxn2 A G 19: 46,579,592 (GRCm39) R252G probably benign Het
Sh2d2a C A 3: 87,759,027 (GRCm39) probably null Het
Sh3gl1 T C 17: 56,325,953 (GRCm39) K159E possibly damaging Het
Slc7a9 A G 7: 35,152,926 (GRCm39) T115A probably benign Het
Spmap1 A T 11: 97,666,525 (GRCm39) Y54N probably damaging Het
Synj2 A T 17: 6,078,718 (GRCm39) D1020V probably damaging Het
Tenm2 C A 11: 35,942,644 (GRCm39) V1342L probably benign Het
Tmem127 T A 2: 127,090,652 (GRCm39) I56N possibly damaging Het
Traj7 A G 14: 54,448,938 (GRCm39) probably benign Het
Unc5d A G 8: 29,184,620 (GRCm39) F627L probably damaging Het
Unc79 T A 12: 103,041,062 (GRCm39) N698K probably benign Het
Usp17la A T 7: 104,510,937 (GRCm39) N514I possibly damaging Het
Uvrag A T 7: 98,637,427 (GRCm39) C341S probably damaging Het
Zfp810 T C 9: 22,189,531 (GRCm39) D459G probably benign Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25,370,097 (GRCm39) missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25,370,090 (GRCm39) missense probably benign 0.13
IGL01912:Clcn7 APN 17 25,371,983 (GRCm39) splice site probably benign
IGL01936:Clcn7 APN 17 25,374,350 (GRCm39) missense probably benign 0.44
IGL02084:Clcn7 APN 17 25,376,899 (GRCm39) missense probably benign
IGL02121:Clcn7 APN 17 25,372,058 (GRCm39) missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25,368,004 (GRCm39) unclassified probably benign
IGL02335:Clcn7 APN 17 25,365,821 (GRCm39) missense probably benign 0.00
IGL02507:Clcn7 APN 17 25,363,443 (GRCm39) missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25,365,792 (GRCm39) missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25,365,427 (GRCm39) unclassified probably benign
IGL03192:Clcn7 APN 17 25,352,575 (GRCm39) missense probably benign 0.00
IGL03194:Clcn7 APN 17 25,369,522 (GRCm39) missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25,374,359 (GRCm39) missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25,372,728 (GRCm39) missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25,368,176 (GRCm39) unclassified probably benign
R0970:Clcn7 UTSW 17 25,370,208 (GRCm39) critical splice donor site probably null
R1644:Clcn7 UTSW 17 25,378,672 (GRCm39) missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25,379,445 (GRCm39) missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25,363,425 (GRCm39) missense probably benign
R2173:Clcn7 UTSW 17 25,364,583 (GRCm39) missense probably benign
R2401:Clcn7 UTSW 17 25,372,114 (GRCm39) missense probably benign 0.02
R2511:Clcn7 UTSW 17 25,374,420 (GRCm39) missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25,369,567 (GRCm39) missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25,378,681 (GRCm39) missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25,379,150 (GRCm39) missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25,376,935 (GRCm39) missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25,372,539 (GRCm39) intron probably benign
R5372:Clcn7 UTSW 17 25,376,153 (GRCm39) missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25,368,026 (GRCm39) missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25,376,928 (GRCm39) missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25,370,702 (GRCm39) missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25,376,502 (GRCm39) missense probably benign 0.01
R6798:Clcn7 UTSW 17 25,378,734 (GRCm39) missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25,376,188 (GRCm39) missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25,365,325 (GRCm39) missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25,372,667 (GRCm39) missense
R7757:Clcn7 UTSW 17 25,375,796 (GRCm39) missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25,368,233 (GRCm39) nonsense probably null
R8670:Clcn7 UTSW 17 25,378,588 (GRCm39) missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25,376,497 (GRCm39) missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25,374,471 (GRCm39) missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25,369,200 (GRCm39) missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25,371,989 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCAGACAAGTGCCTGGTG -3'
(R):5'- GAGAAAGTAATGTTTCTGGGGTTCC -3'

Sequencing Primer
(F):5'- ACAAGTGCCTGGTGAGGGTG -3'
(R):5'- TTCCTAGGAGCCATCAGAGG -3'
Posted On 2015-02-19