Incidental Mutation 'R3731:Setx'
ID270961
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3731 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGGCT to GT at 29154061 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably null
Transcript: ENSMUST00000061578
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135992
Meta Mutation Damage Score 0.6416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCCTTCCAGTATATAGAGAGAATTC -3'
(R):5'- AGCAATAAACTCAGGATCTTAGGTGG -3'

Sequencing Primer
(F):5'- ACTTTGGAACTTAGTGCAAAGG -3'
(R):5'- CTCAGGATCTTAGGTGGGAAAATAG -3'
Posted On2015-03-18