Incidental Mutation 'R3733:Bcl7b'
ID271081
Institutional Source Beutler Lab
Gene Symbol Bcl7b
Ensembl Gene ENSMUSG00000029681
Gene NameB cell CLL/lymphoma 7B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R3733 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135168283-135181855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135180913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000106819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031692] [ENSMUST00000111188] [ENSMUST00000202606]
Predicted Effect probably benign
Transcript: ENSMUST00000031692
AA Change: T198A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031692
Gene: ENSMUSG00000029681
AA Change: T198A

DomainStartEndE-ValueType
Pfam:BCL_N 3 51 1.5e-31 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111188
AA Change: T141A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106819
Gene: ENSMUSG00000029681
AA Change: T141A

DomainStartEndE-ValueType
Pfam:BCL_N 2 53 5.2e-32 PFAM
low complexity region 54 62 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145329
Predicted Effect probably benign
Transcript: ENSMUST00000202606
SMART Domains Protein: ENSMUSP00000144538
Gene: ENSMUSG00000029681

DomainStartEndE-ValueType
Pfam:BCL_N 2 25 3.8e-11 PFAM
low complexity region 28 36 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Bcl7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Bcl7b APN 5 135180096 missense probably damaging 1.00
R0468:Bcl7b UTSW 5 135180883 missense probably benign 0.18
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R3732:Bcl7b UTSW 5 135180913 missense probably benign 0.00
R4857:Bcl7b UTSW 5 135173179 makesense probably null
R5020:Bcl7b UTSW 5 135171163 critical splice donor site probably null
R6347:Bcl7b UTSW 5 135180533 missense possibly damaging 0.90
R6391:Bcl7b UTSW 5 135180025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTCACCTAAAAGCAGGC -3'
(R):5'- AGCGCTCCTTTGCTCAAGAG -3'

Sequencing Primer
(F):5'- TCACCTAAAAGCAGGCAGAGG -3'
(R):5'- AAGATGGTGCGACGACCC -3'
Posted On2015-03-18