Incidental Mutation 'R3733:Ergic2'
ID271086
Institutional Source Beutler Lab
Gene Symbol Ergic2
Ensembl Gene ENSMUSG00000030304
Gene NameERGIC and golgi 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R3733 (G1)
Quality Score224
Status Not validated
Chromosome6
Chromosomal Location148179079-148212374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148202522 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 79 (D79G)
Ref Sequence ENSEMBL: ENSMUSP00000116551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032446] [ENSMUST00000126698] [ENSMUST00000130242] [ENSMUST00000136008]
Predicted Effect probably benign
Transcript: ENSMUST00000032446
Predicted Effect probably damaging
Transcript: ENSMUST00000032447
AA Change: D79G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032447
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 12 105 1.5e-22 PFAM
Pfam:COPIIcoated_ERV 158 300 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125469
Predicted Effect probably damaging
Transcript: ENSMUST00000126698
AA Change: D79G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116551
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 12 100 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132413
Predicted Effect probably damaging
Transcript: ENSMUST00000136008
AA Change: D79G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120456
Gene: ENSMUSG00000030304
AA Change: D79G

DomainStartEndE-ValueType
Pfam:ERGIC_N 13 101 1.6e-26 PFAM
Pfam:COPIIcoated_ERV 157 333 4.8e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203993
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERGIC2, or PTX1, is a ubiquitously expressed nuclear protein that is downregulated in prostate carcinoma (Kwok et al., 2001 [PubMed 11445006]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for an ENU-induced point mutation affecting the donor splice site of intron 5 exhibit swelling of the hind feet and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mrps18b G A 17: 35,910,867 P97S probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in Ergic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Ergic2 APN 6 148195271 missense probably benign
IGL02191:Ergic2 APN 6 148204821 missense probably null 0.12
IGL02719:Ergic2 APN 6 148204819 missense possibly damaging 0.82
IGL02958:Ergic2 APN 6 148181943 makesense probably null
R0389:Ergic2 UTSW 6 148183202 missense probably benign 0.40
R0416:Ergic2 UTSW 6 148183144 missense probably damaging 1.00
R0727:Ergic2 UTSW 6 148199400 unclassified probably benign
R1835:Ergic2 UTSW 6 148189581 missense possibly damaging 0.61
R1891:Ergic2 UTSW 6 148183079 missense probably damaging 0.99
R1959:Ergic2 UTSW 6 148199354 critical splice donor site probably null
R2504:Ergic2 UTSW 6 148204774 critical splice donor site probably null
R3414:Ergic2 UTSW 6 148206681 splice site probably benign
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3734:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R5002:Ergic2 UTSW 6 148184158 missense probably benign 0.00
R5083:Ergic2 UTSW 6 148196014 missense probably benign 0.00
R5088:Ergic2 UTSW 6 148183123 missense probably damaging 1.00
R5850:Ergic2 UTSW 6 148183107 missense possibly damaging 0.93
R6541:Ergic2 UTSW 6 148183150 missense probably damaging 1.00
R6652:Ergic2 UTSW 6 148189581 missense probably damaging 1.00
R7073:Ergic2 UTSW 6 148195209 missense probably damaging 1.00
R7167:Ergic2 UTSW 6 148206635 missense probably damaging 1.00
R7275:Ergic2 UTSW 6 148195259 missense probably damaging 1.00
R7299:Ergic2 UTSW 6 148188112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGACTCTACACTGGAGAC -3'
(R):5'- TTGCAGTTAACAAAGGTGACTG -3'

Sequencing Primer
(F):5'- TGGAGACAGACTACCTAAAGCAC -3'
(R):5'- TGTCAGGCTGTTCACACAAAAG -3'
Posted On2015-03-18