Incidental Mutation 'R3777:Mypn'
ID271851
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R3777 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63147982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 496 (T496A)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095580
AA Change: T496A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: T496A

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Dsg1b G A 18: 20,399,587 V563I probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Fmn1 A G 2: 113,365,122 E389G unknown Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr142 T C 2: 90,252,625 Y121C probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
R7477:Mypn UTSW 10 63125721 missense possibly damaging 0.89
R7534:Mypn UTSW 10 63193131 missense probably benign 0.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGTTCATACGTAAACTGGGAAG -3'
(R):5'- CCAGAGCTGTTGGTTTTAGAAC -3'

Sequencing Primer
(F):5'- GGAAAGATGACTATGAAGTTCACCC -3'
(R):5'- AGAACTTTGGGCTCCTTCAG -3'
Posted On2015-03-25