Incidental Mutation 'R3792:Ilk'
ID272590
Institutional Source Beutler Lab
Gene Symbol Ilk
Ensembl Gene ENSMUSG00000030890
Gene Nameintegrin linked kinase
SynonymsESTM24
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105736592-105742925 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 105742087 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 73 (W73*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably damaging
Transcript: ENSMUST00000033182
AA Change: A357T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890
AA Change: A357T

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000098148
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127298
Predicted Effect probably benign
Transcript: ENSMUST00000130565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138150
AA Change: W73*
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148971
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152508
Predicted Effect probably benign
Transcript: ENSMUST00000153557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect probably damaging
Transcript: ENSMUST00000163389
AA Change: A357T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890
AA Change: A357T

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Nullizygous embryos do not polarize the epiblast and die after implantation. Mice with mutations in the ATP-binding site show aphagia, hunched posture, and neonatal death due to renal aplasia. Mice with mutations in the paxillin-binding site show vasculogenesis and growth defects, and die at ~E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Ilk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ilk APN 7 105741169 missense probably benign 0.45
IGL02326:Ilk APN 7 105741633 missense probably damaging 1.00
IGL02969:Ilk APN 7 105740340 missense possibly damaging 0.71
IGL03115:Ilk APN 7 105740335 missense probably damaging 0.99
R3408:Ilk UTSW 7 105740974 missense probably benign
R4879:Ilk UTSW 7 105741804 missense probably benign 0.00
R5011:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5013:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5147:Ilk UTSW 7 105742567 missense possibly damaging 0.87
R5689:Ilk UTSW 7 105741650 missense probably benign
R5837:Ilk UTSW 7 105741171 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TCAATAGCCGCAGTGTAATGG -3'
(R):5'- TGTCACCAGTTCCCACAGAAG -3'

Sequencing Primer
(F):5'- GTGAGACCACAGTTCACTTCTGG -3'
(R):5'- GTTCCCACAGAAGCACCG -3'
Posted On2015-03-25