Incidental Mutation 'R3792:Vmn2r84'
ID272598
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Namevomeronasal 2, receptor 84
SynonymsEG625068
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3792 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130385316-130394241 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 130385800 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 850 (*850C)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
Predicted Effect probably null
Transcript: ENSMUST00000094502
AA Change: *850C
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: *850C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik A G X: 81,420,817 V428A probably benign Het
Aanat T C 11: 116,596,231 L88P probably damaging Het
Arhgap5 A T 12: 52,519,888 N1214I probably benign Het
BC034090 A T 1: 155,241,797 S192T probably damaging Het
Bco1 G A 8: 117,130,676 V461I possibly damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Cubn G A 2: 13,427,914 R1199C probably damaging Het
Dcaf12l1 T C X: 44,788,436 N495S possibly damaging Het
Dopey2 C A 16: 93,771,846 Q1599K possibly damaging Het
Dyrk1a C A 16: 94,685,074 L427I probably benign Het
Esp16 T C 17: 39,537,848 I11T possibly damaging Het
Esyt3 A T 9: 99,315,281 F832Y possibly damaging Het
F8 A T X: 75,285,365 probably null Het
Fam135a T C 1: 24,028,311 Y259C probably benign Het
Fbxo38 T C 18: 62,533,462 probably null Het
Fbxo43 T C 15: 36,162,859 I67M probably benign Het
Gcfc2 G T 6: 81,930,767 C154F probably benign Het
Gm21731 G T 13: 120,240,931 V88F probably damaging Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Ilk G A 7: 105,742,087 W73* probably null Het
Ism1 T C 2: 139,740,253 S162P probably damaging Het
Itpkb T A 1: 180,333,173 L288Q possibly damaging Het
Itpr2 C A 6: 146,415,354 K306N probably damaging Het
Kdm2a C T 19: 4,324,512 E864K possibly damaging Het
Kdm4b G A 17: 56,355,944 V172M probably damaging Het
Kyat3 A T 3: 142,737,844 K406M probably null Het
Lipe T A 7: 25,397,620 K299N possibly damaging Het
Lrrc2 T A 9: 110,966,517 C123* probably null Het
Mptx2 T A 1: 173,274,673 I150F probably damaging Het
Mroh2b G T 15: 4,923,620 W612L probably damaging Het
Mucl2 T C 15: 103,898,426 T27A possibly damaging Het
Nfx1 T A 4: 41,004,357 C709* probably null Het
Olfr164 A G 16: 19,285,946 S266P possibly damaging Het
Olfr624 A T 7: 103,670,146 I295N probably damaging Het
Oprm1 T C 10: 6,839,544 S390P probably benign Het
Pcdhb14 T C 18: 37,449,662 L607P probably damaging Het
Rap1gds1 A T 3: 138,965,960 I133N probably damaging Het
Rasl10a T C 11: 5,059,461 L83S probably damaging Het
Satb2 C T 1: 56,845,620 V382M probably damaging Het
Sh3gl1 T C 17: 56,018,949 K160R probably damaging Het
Sirt4 T C 5: 115,480,292 D241G probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spef2 A G 15: 9,704,536 I454T probably damaging Het
Stag3 A G 5: 138,298,349 K490E probably benign Het
Tctn3 T C 19: 40,611,711 K95R probably benign Het
Tdgf1 C T 9: 110,943,190 R46Q probably benign Het
Trp53bp1 T C 2: 121,200,329 I1784V probably damaging Het
Ttc21a A T 9: 119,954,165 E511V probably damaging Het
Ttn A G 2: 76,711,888 F25258L probably damaging Het
Ttn A C 2: 76,808,946 C13828G probably damaging Het
Vmn1r210 T A 13: 22,827,403 M238L probably damaging Het
Vmn1r38 A G 6: 66,776,907 I75T probably benign Het
Vwa7 T C 17: 35,025,159 probably null Het
Zfp128 T A 7: 12,884,732 D52E probably damaging Het
Zfp618 T C 4: 63,115,491 probably benign Het
Zkscan2 T A 7: 123,485,002 E633V possibly damaging Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1521:Vmn2r84 UTSW 10 130389268 missense probably benign 0.10
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4190:Vmn2r84 UTSW 10 130391294 nonsense probably null
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6607:Vmn2r84 UTSW 10 130390862 missense possibly damaging 0.87
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6956:Vmn2r84 UTSW 10 130389267 missense probably damaging 0.98
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7225:Vmn2r84 UTSW 10 130386683 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAAAACCATTTTCCACCAACTCTGG -3'
(R):5'- GACAGATTCAATGAAGCCAAGTTC -3'

Sequencing Primer
(F):5'- GGACAGTGCTATCCTGTT -3'
(R):5'- CTAACTTTCAGCATGCTGGTG -3'
Posted On2015-03-25