Incidental Mutation 'R0385:Gnptab'
ID31238
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0385 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88436525 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1009 (I1009T)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: I1009T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: I1009T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAAAGTCCCTGCACACATGC -3'
(R):5'- GGCCCTGAATGAACCTGTCACAAG -3'

Sequencing Primer
(F):5'- GGATCGTTATGCAAGAACTCC -3'
(R):5'- CTGTCACAAGGATCATGTGC -3'
Posted On2013-04-24