Incidental Mutation 'R4026:Top2b'
ID313000
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16409189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense not run
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense not run
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCATGGAGAAGTAAGCACTG -3'
(R):5'- TGAAGTACTCTCCCTGAGCAG -3'

Sequencing Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On2015-04-30