Incidental Mutation 'R4026:Gm5581'
ID312984
Institutional Source Beutler Lab
Gene Symbol Gm5581
Ensembl Gene ENSMUSG00000061969
Gene Namepredicted gene 5581
Synonyms
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131166365-131182379 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 131167068 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072940
SMART Domains Protein: ENSMUSP00000072710
Gene: ENSMUSG00000061969

DomainStartEndE-ValueType
KRAB 8 68 1.79e-34 SMART
low complexity region 285 302 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
PDB:1MEY|G 422 507 4e-15 PDB
Blast:HNHc 445 504 4e-6 BLAST
ZnF_C2H2 509 531 9.73e-4 SMART
ZnF_C2H2 537 559 1.5e-4 SMART
ZnF_C2H2 565 587 1.98e-4 SMART
ZnF_C2H2 593 615 1.52e-5 SMART
ZnF_C2H2 621 643 9.73e-4 SMART
ZnF_C2H2 649 671 9.36e-6 SMART
ZnF_C2H2 677 699 3.49e-5 SMART
ZnF_C2H2 705 727 9.88e-5 SMART
ZnF_C2H2 733 755 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204992
Meta Mutation Damage Score 0.0352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Gm5581
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Gm5581 APN 6 131167641 unclassified noncoding transcript
IGL01372:Gm5581 APN 6 131168403 exon noncoding transcript
IGL01630:Gm5581 APN 6 131168296 exon noncoding transcript
IGL01667:Gm5581 APN 6 131167772 unclassified noncoding transcript
IGL02260:Gm5581 APN 6 131167946 unclassified noncoding transcript
IGL03212:Gm5581 APN 6 131181450 exon noncoding transcript
IGL03306:Gm5581 APN 6 131168081 unclassified noncoding transcript
R0366:Gm5581 UTSW 6 131166447 unclassified noncoding transcript
R1764:Gm5581 UTSW 6 131181399 exon noncoding transcript
R1961:Gm5581 UTSW 6 131168162 unclassified noncoding transcript
R2129:Gm5581 UTSW 6 131168284 exon noncoding transcript
R3177:Gm5581 UTSW 6 131166965 unclassified noncoding transcript
R4289:Gm5581 UTSW 6 131167556 unclassified noncoding transcript
R4943:Gm5581 UTSW 6 131167125 unclassified noncoding transcript
R4961:Gm5581 UTSW 6 131167227 unclassified noncoding transcript
R5817:Gm5581 UTSW 6 131167169 unclassified noncoding transcript
R5944:Gm5581 UTSW 6 131168400 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGGTTTCTCTCCTGTGTGAATTC -3'
(R):5'- TATCCAGTCCTCAAATCTTCAAGC -3'

Sequencing Primer
(F):5'- CTCCTGTGTGAATTCTGTAGTGAAC -3'
(R):5'- TTTGCCATGAAAACTGTACAGGAG -3'
Posted On2015-04-30