Incidental Mutation 'R0387:Cyp2u1'
ID31331
Institutional Source Beutler Lab
Gene Symbol Cyp2u1
Ensembl Gene ENSMUSG00000027983
Gene Namecytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131288441-131303227 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 131295552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106337] [ENSMUST00000200236]
Predicted Effect probably null
Transcript: ENSMUST00000106337
SMART Domains Protein: ENSMUSP00000101944
Gene: ENSMUSG00000027983

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 527 4.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198606
Predicted Effect probably null
Transcript: ENSMUST00000200236
SMART Domains Protein: ENSMUSP00000142519
Gene: ENSMUSG00000027983

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 473 1.1e-108 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Cyp2u1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Cyp2u1 APN 3 131297951 missense probably damaging 1.00
IGL02365:Cyp2u1 APN 3 131298229 missense probably damaging 1.00
R0781:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1110:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1620:Cyp2u1 UTSW 3 131302701 missense probably damaging 0.98
R3087:Cyp2u1 UTSW 3 131303027 missense probably benign
R3845:Cyp2u1 UTSW 3 131293486 missense possibly damaging 0.66
R4996:Cyp2u1 UTSW 3 131298284 missense probably benign 0.00
R5913:Cyp2u1 UTSW 3 131303211 unclassified probably benign
R6815:Cyp2u1 UTSW 3 131298010 missense probably damaging 1.00
R6903:Cyp2u1 UTSW 3 131302775 missense probably benign 0.03
R6932:Cyp2u1 UTSW 3 131298296 missense possibly damaging 0.94
R7067:Cyp2u1 UTSW 3 131293553 missense probably damaging 1.00
R7193:Cyp2u1 UTSW 3 131291143 missense probably benign
R7262:Cyp2u1 UTSW 3 131297956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACCCAGGACCTTTCTGATGTG -3'
(R):5'- GCTGTCCATCAAAGCTCCAGTGTG -3'

Sequencing Primer
(F):5'- ACTCGGAGGATTCCCTCAG -3'
(R):5'- AAGCTCCAGTGTGGCAGG -3'
Posted On2013-04-24