Incidental Mutation 'R4065:Abcc9'
ID316058
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission 040972-MU
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4065 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142645890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 769 (E769G)
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably damaging
Transcript: ENSMUST00000073173
AA Change: E769G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249
AA Change: E769G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087527
AA Change: E804G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249
AA Change: E804G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100827
AA Change: E804G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249
AA Change: E804G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111771
AA Change: E791G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249
AA Change: E791G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205202
AA Change: E769G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249
AA Change: E769G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2019:Abcc9 UTSW 6 142675434 missense probably damaging 1.00
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4659:Abcc9 UTSW 6 142672595 splice site probably null
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4832:Abcc9 UTSW 6 142671556 missense probably damaging 1.00
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6478:Abcc9 UTSW 6 142679308 missense probably damaging 1.00
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGTGTCAAAGGATGCC -3'
(R):5'- AGTGATGCCCCAAAACTAAATG -3'

Sequencing Primer
(F):5'- CAAAGGATGCCTGCCCTTATATTTTG -3'
(R):5'- CTAAATGGGGGAAGAAGAGGGTC -3'
Posted On2015-05-15