Incidental Mutation 'R2019:Abcc9'
ID223623
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission 040028-MU
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R2019 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 142675434 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 527 (L527F)
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably damaging
Transcript: ENSMUST00000073173
AA Change: L527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249
AA Change: L527F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087527
AA Change: L527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249
AA Change: L527F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100827
AA Change: L527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249
AA Change: L527F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111771
AA Change: L527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249
AA Change: L527F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205202
AA Change: L527F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249
AA Change: L527F

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Ptgis A G 2: 167,208,279 V310A probably damaging Het
Ptgis G A 2: 167,214,810 Q286* probably null Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4065:Abcc9 UTSW 6 142645890 missense probably damaging 1.00
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4659:Abcc9 UTSW 6 142672595 splice site probably null
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4832:Abcc9 UTSW 6 142671556 missense probably damaging 1.00
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6478:Abcc9 UTSW 6 142679308 missense probably damaging 1.00
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCCTGTACTTGCACTGG -3'
(R):5'- TGAAGGCATGAGCATCTCTGG -3'

Sequencing Primer
(F):5'- CACTGGTCTTTATCTTTGGTGCGAAG -3'
(R):5'- ATGAGCATCTCTGGGCCCTG -3'
Posted On2014-08-25